MENU
The Electronic Scholarly Publishing Project: Providing world-wide, free access to classic scientific papers and other scholarly materials, since 1993.
More About: ESP | OUR CONTENT | THIS WEBSITE | WHAT'S NEW | WHAT'S HOT
ESP: PubMed Auto Bibliography 12 Mar 2026 at 01:53 Created:
Invasive Species
Standard Definition: Invasive species are plants, animals, or pathogens that are non-native (or alien) to the ecosystem under consideration and whose introduction causes or is likely to cause harm. Although that definition allows a logical possibility that some species might be non-native and harmless, most of time it seems that invasive species and really bad critter (or weed) that should be eradicated are seen as equivalent phrases. But, there is a big conceptual problem with that notion: every species in every ecosystem started out in that ecosystem as an invader. If there were no invasive species, all of Hawaii would be nothing but bare volcanic rock. Without an invasion of species onto land, there would be no terrestrial ecosystems at all. For the entire history of life on Earth, the biosphere has responded to perturbation and to opportunity with evolutionary innovation and with physical movement. While one may raise economic or aesthetic arguments against invasive species, it is impossible to make such an argument on scientific grounds. Species movement — the occurrence of invasive species — is the way the biosphere responds to perturbation. One might even argue that species movement is the primary, short-term "healing" mechanism employed by the biosphere to respond to perturbation — to "damage." As with any healing process, the short-term effect may be aesthetically unappealing (who thinks scabs are appealing?), but the long-term effects can be glorious.
Created with PubMed® Query: ("invasive species" OR "invasion biology" OR "alien species" OR "introduced species" ) NOT pmcbook NOT ispreviousversion
Citations The Papers (from PubMed®)
RevDate: 2026-03-11
Role of Gut Bacteria in Tomato Leaf Miner Tuta absoluta Gaining Resistance to α-Tomatine by Converting It to Cholesterol.
Journal of agricultural and food chemistry [Epub ahead of print].
Tuta absoluta is a worldwide invasive pest that causes severe losses in tomato industry in China, while its resistance mechanism to tomato's protective alkaloid of α-tomatine remains unclear. This study explores the role of its gut microbiota, and results showed that the abundance of the gut symbiont Enterococcus mundtii was significantly higher in T. absoluta feeding on wild-type tomatoes than that in those feeding on α-tomatine-deficient GAME2 mutant tomatoes. Isolated E. mundtii strain E14 degraded 72.2 ± 1.3% of α-tomatine in vitro; reinoculating it into antibiotic-treated T. absoluta restored the degradation ability. Inoculating E14 into five other lepidopteran pests (except noncolonized Plutella xylostella) enhanced their α-tomatine tolerance. Multiomics and in vitro pure-culture experiments showed that α-tomatine degrades into cholesterol via deglycosylation, reduction, and hydrolysis. This study reveals α-tomatine's dual role (toxin/cholesterol precursor) and E. mundtii as a key adaptation mediator, advancing our understanding of insect-plant coevolution and invasive pest control.
Additional Links: PMID-41808257
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41808257,
year = {2026},
author = {Chen, Y and Chen, Y and Du, E and Chen, X and Liu, W and Li, Y and Zeng, N and Zi, X and He, Q and Li, Z and Su, R and Gui, F},
title = {Role of Gut Bacteria in Tomato Leaf Miner Tuta absoluta Gaining Resistance to α-Tomatine by Converting It to Cholesterol.},
journal = {Journal of agricultural and food chemistry},
volume = {},
number = {},
pages = {},
doi = {10.1021/acs.jafc.5c16815},
pmid = {41808257},
issn = {1520-5118},
abstract = {Tuta absoluta is a worldwide invasive pest that causes severe losses in tomato industry in China, while its resistance mechanism to tomato's protective alkaloid of α-tomatine remains unclear. This study explores the role of its gut microbiota, and results showed that the abundance of the gut symbiont Enterococcus mundtii was significantly higher in T. absoluta feeding on wild-type tomatoes than that in those feeding on α-tomatine-deficient GAME2 mutant tomatoes. Isolated E. mundtii strain E14 degraded 72.2 ± 1.3% of α-tomatine in vitro; reinoculating it into antibiotic-treated T. absoluta restored the degradation ability. Inoculating E14 into five other lepidopteran pests (except noncolonized Plutella xylostella) enhanced their α-tomatine tolerance. Multiomics and in vitro pure-culture experiments showed that α-tomatine degrades into cholesterol via deglycosylation, reduction, and hydrolysis. This study reveals α-tomatine's dual role (toxin/cholesterol precursor) and E. mundtii as a key adaptation mediator, advancing our understanding of insect-plant coevolution and invasive pest control.},
}
RevDate: 2026-03-10
CmpDate: 2026-03-11
Expanding invasive species impact assessments to the ecosystem level with EEICAT.
PLoS biology, 24(3):e3003665.
The ecological impacts of biological invasions vary widely in type, scale, and severity, highlighting the need for consistent assessment tools. The Environmental Impact Classification for Alien Taxa (EICAT) provides a standardized framework for assessing their effects, but focuses mainly on population-level impacts. We introduce the Extended EICAT (EEICAT), which incorporates impacts across three ecological dimensions, from individuals to ecosystems, with an impact-based approach. EEICAT enables classification of 19 impact types at the invasion-event level, making it suitable for primary research, synthesis, and management. This framework aims to improve the detection, comparison, and communication of complex ecological impacts caused by biological invasions.
Additional Links: PMID-41805746
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41805746,
year = {2026},
author = {Carneiro, L and Pincheira-Donoso, D and Leroy, B and Bertolino, S and Camacho-Cervantes, M and Cuthbert, RN and Bang, A and Catford, JA and South, J and Cooke, SJ and Angulo, E and Courchamp, F},
title = {Expanding invasive species impact assessments to the ecosystem level with EEICAT.},
journal = {PLoS biology},
volume = {24},
number = {3},
pages = {e3003665},
pmid = {41805746},
issn = {1545-7885},
mesh = {*Introduced Species ; *Ecosystem ; Animals ; },
abstract = {The ecological impacts of biological invasions vary widely in type, scale, and severity, highlighting the need for consistent assessment tools. The Environmental Impact Classification for Alien Taxa (EICAT) provides a standardized framework for assessing their effects, but focuses mainly on population-level impacts. We introduce the Extended EICAT (EEICAT), which incorporates impacts across three ecological dimensions, from individuals to ecosystems, with an impact-based approach. EEICAT enables classification of 19 impact types at the invasion-event level, making it suitable for primary research, synthesis, and management. This framework aims to improve the detection, comparison, and communication of complex ecological impacts caused by biological invasions.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Introduced Species
*Ecosystem
Animals
RevDate: 2026-03-11
CmpDate: 2026-03-11
Behavior-based stratified management: population suppression and invasion front control of Hylurgus ligniperda (Fabricius) in coastal shelterbelt ecosystems.
Pest management science, 82(4):3384-3394.
BACKGROUND: The red-haired bark beetle (RHB), Hylurgus ligniperda (Fabricius), is a significant invasive pest responsible for widespread mortality in pine forests. Current control methods are largely ineffective and poorly integrated, failing to halt the spread of RHB. This study aimed to develop and validate an integrated management system that leverages the beetle's behavioral patterns and implements stratified management strategies based on the severity of infestation levels.
RESULTS: We first enhanced trapping efficiency by optimizing key technologies, including trap design, deployment methods, and lure formulations. Building on this foundation, we developed a stratified management plan with the following key measures: in newly colonized stands, a strategy combining benzyl alcohol repellents and optimized lure attractants, along with flight-interception traps, significantly reduced spread, decreasing the proportion of dead trees from 12.5% to 2.6%. In outbreak stands, intensive measures such as stump removal and mass trapping reduced the RHB population density by 99.05%. Additionally, replanting alters stand volatiles, reducing their attractiveness to the beetles.
CONCLUSION: The stratified management strategy, applied to both newly colonized and outbreak stands of RHB, proved highly effective in suppressing population growth and preventing further dispersal. This approach offers a key technical solution for restoring damaged coastal ecosystems and provides a valuable reference for managing similar invasive pests worldwide. © 2025 Society of Chemical Industry.
Additional Links: PMID-41410089
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41410089,
year = {2026},
author = {Chen, H and Xie, D and Pan, Z and Jia, N and Zhou, J and Yang, Q and Yu, J and Chi, D},
title = {Behavior-based stratified management: population suppression and invasion front control of Hylurgus ligniperda (Fabricius) in coastal shelterbelt ecosystems.},
journal = {Pest management science},
volume = {82},
number = {4},
pages = {3384-3394},
doi = {10.1002/ps.70465},
pmid = {41410089},
issn = {1526-4998},
support = {//National Key Research and Development Program of China (2021YFD1400300)/ ; },
mesh = {Animals ; *Insect Control/methods ; *Introduced Species ; Pinus/growth & development ; *Weevils/physiology ; Ecosystem ; *Coleoptera/physiology ; Behavior, Animal ; },
abstract = {BACKGROUND: The red-haired bark beetle (RHB), Hylurgus ligniperda (Fabricius), is a significant invasive pest responsible for widespread mortality in pine forests. Current control methods are largely ineffective and poorly integrated, failing to halt the spread of RHB. This study aimed to develop and validate an integrated management system that leverages the beetle's behavioral patterns and implements stratified management strategies based on the severity of infestation levels.
RESULTS: We first enhanced trapping efficiency by optimizing key technologies, including trap design, deployment methods, and lure formulations. Building on this foundation, we developed a stratified management plan with the following key measures: in newly colonized stands, a strategy combining benzyl alcohol repellents and optimized lure attractants, along with flight-interception traps, significantly reduced spread, decreasing the proportion of dead trees from 12.5% to 2.6%. In outbreak stands, intensive measures such as stump removal and mass trapping reduced the RHB population density by 99.05%. Additionally, replanting alters stand volatiles, reducing their attractiveness to the beetles.
CONCLUSION: The stratified management strategy, applied to both newly colonized and outbreak stands of RHB, proved highly effective in suppressing population growth and preventing further dispersal. This approach offers a key technical solution for restoring damaged coastal ecosystems and provides a valuable reference for managing similar invasive pests worldwide. © 2025 Society of Chemical Industry.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Insect Control/methods
*Introduced Species
Pinus/growth & development
*Weevils/physiology
Ecosystem
*Coleoptera/physiology
Behavior, Animal
RevDate: 2026-03-11
CmpDate: 2026-03-11
Invasive alien plant biomass-derived hard carbon anode for sodium-ion batteries.
Chemosphere, 343:140220.
In the context of rampant growth of invasive plants, finding suitable ways for resource utilization has become the optimal choice for invasive plant management. In the field of energy storage, sodium-ion batteries have been limited by the lack of appropriate anode materials, and hard carbon stands out as the most promising candidate. Therefore, this study focuses on the preparation of biomass-derived carbons from three invasive plant species, namely Spartina alterniflora Loisel., Solidago canadensis L., and Erigeron canadensis L., through high-temperature carbonization. The resulting biomass carbons are then subjected to cleaning and activation processes to prepare sodium-ion anode materials. The internal structure of the materials was characterized using SEM, TEM, XRD, XPS, Raman spectroscopy, and BET. The materials exhibited a significant amount of pore structures, with interlayer spacing around 0.37 nm, which is larger than the original graphite interlayer spacing. The plant anode materials were assembled into full batteries for cyclic charge/discharge tests. The results show that all three anode materials have good multiplicative performance and excellent cyclable charge/discharge. After 100 cycles at a current of 50 mA in the voltage range of 0-3.0 V, the reversible capacities of the three materials reached 245.3, 207.19, and 227.12 mAh/g, respectively. Among them, the material derived from Spartina alterniflora maintained a capacity of 141.63 mAh/g even after 1000 cycles at a current of 200 mA, demonstrating the best capacity performance.
Additional Links: PMID-37739130
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37739130,
year = {2023},
author = {Wei, H and Cheng, H and Yao, N and Li, G and Du, Z and Luo, R and Zheng, Z},
title = {Invasive alien plant biomass-derived hard carbon anode for sodium-ion batteries.},
journal = {Chemosphere},
volume = {343},
number = {},
pages = {140220},
doi = {10.1016/j.chemosphere.2023.140220},
pmid = {37739130},
issn = {1879-1298},
mesh = {Biomass ; Electrodes ; *Carbon/chemistry ; *Electric Power Supplies ; *Sodium/chemistry ; *Introduced Species ; },
abstract = {In the context of rampant growth of invasive plants, finding suitable ways for resource utilization has become the optimal choice for invasive plant management. In the field of energy storage, sodium-ion batteries have been limited by the lack of appropriate anode materials, and hard carbon stands out as the most promising candidate. Therefore, this study focuses on the preparation of biomass-derived carbons from three invasive plant species, namely Spartina alterniflora Loisel., Solidago canadensis L., and Erigeron canadensis L., through high-temperature carbonization. The resulting biomass carbons are then subjected to cleaning and activation processes to prepare sodium-ion anode materials. The internal structure of the materials was characterized using SEM, TEM, XRD, XPS, Raman spectroscopy, and BET. The materials exhibited a significant amount of pore structures, with interlayer spacing around 0.37 nm, which is larger than the original graphite interlayer spacing. The plant anode materials were assembled into full batteries for cyclic charge/discharge tests. The results show that all three anode materials have good multiplicative performance and excellent cyclable charge/discharge. After 100 cycles at a current of 50 mA in the voltage range of 0-3.0 V, the reversible capacities of the three materials reached 245.3, 207.19, and 227.12 mAh/g, respectively. Among them, the material derived from Spartina alterniflora maintained a capacity of 141.63 mAh/g even after 1000 cycles at a current of 200 mA, demonstrating the best capacity performance.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Biomass
Electrodes
*Carbon/chemistry
*Electric Power Supplies
*Sodium/chemistry
*Introduced Species
RevDate: 2026-03-11
CmpDate: 2026-03-11
Experimental heatwaves facilitate invasion and alter species interactions and composition in a tropical host-parasitoid community.
Global change biology, 29(22):6261-6275.
As mean temperatures increase and heatwaves become more frequent, species are expanding their distributions to colonise new habitats. The resulting novel species interactions will simultaneously shape the temperature-driven reorganization of resident communities. The interactive effects of climate change and climate change-facilitated invasion have rarely been studied in multi-trophic communities, and are likely to differ depending on the nature of the climatic driver (i.e., climate extremes or constant warming). We re-created under laboratory conditions a host-parasitoid community typical of high-elevation rainforest sites in Queensland, Australia, comprising four Drosophila species and two associated parasitoid species. We subjected these communities to an equivalent increase in average temperature in the form of periodic heatwaves or constant warming, in combination with an invasion treatment involving a novel host species from lower-elevation habitats. The two parasitoid species were sensitive to both warming and heatwaves, while the demographic responses of Drosophila species were highly idiosyncratic, reflecting the combined effects of thermal tolerance, parasitism, competition, and facilitation. After multiple generations, our heatwave treatment promoted the establishment of low-elevation species in upland communities. Invasion of the low-elevation species correlated negatively with the abundance of one of the parasitoid species, leading to cascading effects on its hosts and their competitors. Our study, therefore, reveals differing, sometimes contrasting, impacts of extreme temperatures and constant warming on community composition. It also highlights how the scale and direction of climate impacts could be further modified by invading species within a bi-trophic community network.
Additional Links: PMID-37733768
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37733768,
year = {2023},
author = {Chen, J and Lewis, OT},
title = {Experimental heatwaves facilitate invasion and alter species interactions and composition in a tropical host-parasitoid community.},
journal = {Global change biology},
volume = {29},
number = {22},
pages = {6261-6275},
doi = {10.1111/gcb.16937},
pmid = {37733768},
issn = {1365-2486},
support = {201806010328//China Scholarship Council/ ; NE/N010221/1//Natural Environment Research Council/ ; },
mesh = {Animals ; *Introduced Species ; *Host-Parasite Interactions ; *Drosophila/physiology/parasitology ; Queensland ; *Climate Change ; *Hot Temperature ; Tropical Climate ; Ecosystem ; *Wasps/physiology ; },
abstract = {As mean temperatures increase and heatwaves become more frequent, species are expanding their distributions to colonise new habitats. The resulting novel species interactions will simultaneously shape the temperature-driven reorganization of resident communities. The interactive effects of climate change and climate change-facilitated invasion have rarely been studied in multi-trophic communities, and are likely to differ depending on the nature of the climatic driver (i.e., climate extremes or constant warming). We re-created under laboratory conditions a host-parasitoid community typical of high-elevation rainforest sites in Queensland, Australia, comprising four Drosophila species and two associated parasitoid species. We subjected these communities to an equivalent increase in average temperature in the form of periodic heatwaves or constant warming, in combination with an invasion treatment involving a novel host species from lower-elevation habitats. The two parasitoid species were sensitive to both warming and heatwaves, while the demographic responses of Drosophila species were highly idiosyncratic, reflecting the combined effects of thermal tolerance, parasitism, competition, and facilitation. After multiple generations, our heatwave treatment promoted the establishment of low-elevation species in upland communities. Invasion of the low-elevation species correlated negatively with the abundance of one of the parasitoid species, leading to cascading effects on its hosts and their competitors. Our study, therefore, reveals differing, sometimes contrasting, impacts of extreme temperatures and constant warming on community composition. It also highlights how the scale and direction of climate impacts could be further modified by invading species within a bi-trophic community network.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Introduced Species
*Host-Parasite Interactions
*Drosophila/physiology/parasitology
Queensland
*Climate Change
*Hot Temperature
Tropical Climate
Ecosystem
*Wasps/physiology
RevDate: 2026-03-11
CmpDate: 2026-03-11
Global genomic signature reveals the evolution of fall armyworm in the Eastern hemisphere.
Molecular ecology, 32(20):5463-5478.
The major plant pest fall armyworm (FAW), Spodoptera frugiperda, is native to the Americas and has colonized Africa and Asia within the Eastern hemisphere since 2016, causing severe damage to multiple agricultural crop species. However, the genetic origin of these invasive populations requires more in-depth exploration. We analysed genetic variation across the genomes of 280 FAW individuals from both the Eastern hemisphere and the Americas. The global range-wide genetic structure of FAW shows that the FAW in America has experienced deep differentiation, largely consistent with the Z-chromosomal Tpi haplotypes commonly used to differentiate 'corn-strain' and 'rice-strain' populations. The invasive populations from Africa and Asia are different from the American ones and have a relatively homogeneous population structure, consistent with the common origin and recent spreading from Africa to Asia. Our analyses suggest that north- and central American 'corn-strain' FAW are the most likely sources of the invasion into the Eastern hemisphere. Furthermore, evidence based on genomic, transcriptomic and mitochondrial haplotype network analyses indicates an earlier, independent introduction of FAW into Africa, with subsequent migration into the recent invasive population.
Additional Links: PMID-37638537
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37638537,
year = {2023},
author = {Zhang, L and Li, Z and Peng, Y and Liang, X and Wilson, K and Chipabika, G and Karangwa, P and Uzayisenga, B and Mensah, BA and Kachigamba, DL and Xiao, Y},
title = {Global genomic signature reveals the evolution of fall armyworm in the Eastern hemisphere.},
journal = {Molecular ecology},
volume = {32},
number = {20},
pages = {5463-5478},
doi = {10.1111/mec.17117},
pmid = {37638537},
issn = {1365-294X},
support = {JCYJ20200109150629266//Shenzhen Natural Science Foundation/ ; NIF\R1\191106//The Newton International Fellowship/ ; 2022ZD04021//STI 2030-Major Projects/ ; BB/P023444/1andEP/T024410/1//Global Challenges Research Fund/ ; },
mesh = {Animals ; Haplotypes ; *Spodoptera/genetics ; *Genetics, Population ; Genetic Variation ; *Genome, Insect ; Africa ; Genomics ; Asia ; Introduced Species ; Americas ; *Biological Evolution ; },
abstract = {The major plant pest fall armyworm (FAW), Spodoptera frugiperda, is native to the Americas and has colonized Africa and Asia within the Eastern hemisphere since 2016, causing severe damage to multiple agricultural crop species. However, the genetic origin of these invasive populations requires more in-depth exploration. We analysed genetic variation across the genomes of 280 FAW individuals from both the Eastern hemisphere and the Americas. The global range-wide genetic structure of FAW shows that the FAW in America has experienced deep differentiation, largely consistent with the Z-chromosomal Tpi haplotypes commonly used to differentiate 'corn-strain' and 'rice-strain' populations. The invasive populations from Africa and Asia are different from the American ones and have a relatively homogeneous population structure, consistent with the common origin and recent spreading from Africa to Asia. Our analyses suggest that north- and central American 'corn-strain' FAW are the most likely sources of the invasion into the Eastern hemisphere. Furthermore, evidence based on genomic, transcriptomic and mitochondrial haplotype network analyses indicates an earlier, independent introduction of FAW into Africa, with subsequent migration into the recent invasive population.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
Haplotypes
*Spodoptera/genetics
*Genetics, Population
Genetic Variation
*Genome, Insect
Africa
Genomics
Asia
Introduced Species
Americas
*Biological Evolution
RevDate: 2026-03-11
CmpDate: 2026-03-11
A plague of weasels and ticks: animal introduction, ecological disaster, and the balance of nature in Jamaica, 1870-1900.
British journal for the history of science, 56(3):391-407.
Towards the end of the nineteenth century, British colonists in Jamaica became increasingly exasperated by the damage caused to their sugar plantations by rats. In 1872, a British planter attempted to solve this problem by introducing the small Indian mongoose (Urva auropunctata). The animals, however, turned on Jamaica's insectivorous birds and reptiles, leading to an explosion in the tick population. This paper situates the mongoose catastrophe as a closing chapter in the history of the nineteenth-century acclimatization movement. While foreign observers saw the introduction of the mongoose as a cautionary tale, caricaturing British Jamaica as overrun by a plague of weasels and ticks, British colonists, administrators and naturalists - identifying a gradual decline of both populations - argued that the 'balance of nature' would eventually reassert itself. As this paper argues, through this dubious claim they were attempting to retrospectively rationalize or justify the introductions and their disastrous aftermath. This strategy enabled them to gloss over the lasting ecological damage caused by the mongoose, and allowed its adherents to continue their uncritical support of both the Jamaican plantation economy and animal introductions in the British Empire.
Additional Links: PMID-37608763
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37608763,
year = {2023},
author = {Holmes, M},
title = {A plague of weasels and ticks: animal introduction, ecological disaster, and the balance of nature in Jamaica, 1870-1900.},
journal = {British journal for the history of science},
volume = {56},
number = {3},
pages = {391-407},
doi = {10.1017/S0007087423000286},
pmid = {37608763},
issn = {1474-001X},
mesh = {Animals ; History, 19th Century ; Jamaica ; *Herpestidae ; *Introduced Species/history ; *Ticks ; Colonialism/history ; },
abstract = {Towards the end of the nineteenth century, British colonists in Jamaica became increasingly exasperated by the damage caused to their sugar plantations by rats. In 1872, a British planter attempted to solve this problem by introducing the small Indian mongoose (Urva auropunctata). The animals, however, turned on Jamaica's insectivorous birds and reptiles, leading to an explosion in the tick population. This paper situates the mongoose catastrophe as a closing chapter in the history of the nineteenth-century acclimatization movement. While foreign observers saw the introduction of the mongoose as a cautionary tale, caricaturing British Jamaica as overrun by a plague of weasels and ticks, British colonists, administrators and naturalists - identifying a gradual decline of both populations - argued that the 'balance of nature' would eventually reassert itself. As this paper argues, through this dubious claim they were attempting to retrospectively rationalize or justify the introductions and their disastrous aftermath. This strategy enabled them to gloss over the lasting ecological damage caused by the mongoose, and allowed its adherents to continue their uncritical support of both the Jamaican plantation economy and animal introductions in the British Empire.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
History, 19th Century
Jamaica
*Herpestidae
*Introduced Species/history
*Ticks
Colonialism/history
RevDate: 2026-03-11
CmpDate: 2026-03-11
Plant invasion and fragmentation indirectly and contrastingly affect native plants and grassland arthropods.
The Science of the total environment, 903:166199.
Plant invasion and habitat fragmentation have a detrimental effect on biodiversity in nearly all types of ecosystems. We compared the direct and indirect effects of the invasion of the common milkweed (Asclepias syriaca) on biodiversity patterns in different-sized Hungarian forest-steppe fragments. We assessed vegetation structure, measured temperature and soil moisture, and studied organisms with different ecological roles in invaded and non-invaded sites of fragments: plants, bees, butterflies, flower-visiting wasps, flies, true bugs, and spiders. Temperature and soil moisture were lower in invaded than in non-invaded area. Milkweed had a positive effect on plant species richness and flower abundance. In contrast, we mainly found indirect effects of invasion on arthropods through alteration of physical habitat characteristics and food resources. Pollinators were positively affected by native flowers, thus, milkweed indirectly supported pollinators. Similarly, we found higher species richness of herbivores in invaded sites than control sites, as species richness of true bugs also increased with increasing plant species richness. Predators were positively affected by complex vegetation structure, higher soil moisture and lower temperature. Furthermore, increasing fragment size had a strong negative effect on spider species richness of non-invaded sites, but no effect in invaded sites. Especially, grassland specialist spiders were more sensitive to fragment size than generalists, whereas generalist spider species rather profited from invasion. Although milkweed invades natural areas, we did not identify strong negative effects of its presence on the diversity of the grassland biota. However, the supportive effect of milkweed on a few generalist species homogenises the communities. The rate of invasion might increase with increasing fragmentation, therefore we recommend eliminating invasive plants from small habitat fragments to preserve the native biota. Focusing also on generalist species and revealing the indirect effects of invasions are essential for understanding the invasion mechanisms and would support restoration efforts.
Additional Links: PMID-37572908
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37572908,
year = {2023},
author = {Gallé, R and Tölgyesi, C and Szabó, ÁR and Korányi, D and Bátori, Z and Hábenczyus, A and Török, E and Révész, K and Torma, A and Gallé-Szpisjak, N and Lakatos, T and Batáry, P},
title = {Plant invasion and fragmentation indirectly and contrastingly affect native plants and grassland arthropods.},
journal = {The Science of the total environment},
volume = {903},
number = {},
pages = {166199},
doi = {10.1016/j.scitotenv.2023.166199},
pmid = {37572908},
issn = {1879-1026},
mesh = {*Introduced Species ; *Grassland ; *Biodiversity ; Animals ; *Arthropods/physiology ; *Asclepias/physiology ; Ecosystem ; Hungary ; },
abstract = {Plant invasion and habitat fragmentation have a detrimental effect on biodiversity in nearly all types of ecosystems. We compared the direct and indirect effects of the invasion of the common milkweed (Asclepias syriaca) on biodiversity patterns in different-sized Hungarian forest-steppe fragments. We assessed vegetation structure, measured temperature and soil moisture, and studied organisms with different ecological roles in invaded and non-invaded sites of fragments: plants, bees, butterflies, flower-visiting wasps, flies, true bugs, and spiders. Temperature and soil moisture were lower in invaded than in non-invaded area. Milkweed had a positive effect on plant species richness and flower abundance. In contrast, we mainly found indirect effects of invasion on arthropods through alteration of physical habitat characteristics and food resources. Pollinators were positively affected by native flowers, thus, milkweed indirectly supported pollinators. Similarly, we found higher species richness of herbivores in invaded sites than control sites, as species richness of true bugs also increased with increasing plant species richness. Predators were positively affected by complex vegetation structure, higher soil moisture and lower temperature. Furthermore, increasing fragment size had a strong negative effect on spider species richness of non-invaded sites, but no effect in invaded sites. Especially, grassland specialist spiders were more sensitive to fragment size than generalists, whereas generalist spider species rather profited from invasion. Although milkweed invades natural areas, we did not identify strong negative effects of its presence on the diversity of the grassland biota. However, the supportive effect of milkweed on a few generalist species homogenises the communities. The rate of invasion might increase with increasing fragmentation, therefore we recommend eliminating invasive plants from small habitat fragments to preserve the native biota. Focusing also on generalist species and revealing the indirect effects of invasions are essential for understanding the invasion mechanisms and would support restoration efforts.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Introduced Species
*Grassland
*Biodiversity
Animals
*Arthropods/physiology
*Asclepias/physiology
Ecosystem
Hungary
RevDate: 2026-03-11
CmpDate: 2026-03-11
Behavior of higher trophic levels associated with an invasive plant varies among populations.
Environmental entomology, 52(5):870-878.
Invasive plants from their native and introduced ranges differ in their interactions with herbivores but it is not known whether they also vary in their interactions with herbivore natural enemies. Here, we used olfactometer bioassays and cage experiments to investigate how foraging behaviors of 2 parasitoid and 1 hyperparasitoid species depended on plant population origin. Triadica sebifera (Euphorbiaceae) is native to China but invasive in the United States. In China, it is fed on by a specialist noctuid Gadirtha fusca (Lepidoptera: Nolidae), which hosts a parasitoid Apanteles sp. (Hymenoptera: Microgastinae) and hyperparasitoid (Hymenoptera: Eurytomidae) plus a generalist aphid Toxoptera odinae (Homoptera: Aphidiidae) parasitized by Lysiphlebus confusus (Hymenoptera: Aphidiinae). Both parasitoids preferred plants infested by their host over herbivore-free plants in olfactometer bioassays. Apanteles sp. and Eurytomid wasps preferred G. fusca infested plants from China populations over those from US populations in olfactometer bioassays but L. confusus wasps did not discriminate between T. odinae infested plants from China vs. US populations. Similarly, G. fusca caterpillars on China population plants were more likely to be parasitized than ones on US population plants when they were in the same cage but odds of parasitism for T. odinae did not differ for those on China vs. US population plants. These results suggest that populations from the native and introduced ranges may differ in traits that impact higher trophic levels. This may have implications for successful control of invasive plants as biocontrol agents are introduced or herbivores begin to feed on them in their introduced ranges.
Additional Links: PMID-37530696
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37530696,
year = {2023},
author = {Ismail, M and Siemann, E and Ding, J},
title = {Behavior of higher trophic levels associated with an invasive plant varies among populations.},
journal = {Environmental entomology},
volume = {52},
number = {5},
pages = {870-878},
doi = {10.1093/ee/nvad067},
pmid = {37530696},
issn = {1938-2936},
support = {2016PB030//China National R&D Program/ ; 31370404//National Natural Science Foundation of China/ ; },
mesh = {Animals ; *Introduced Species ; *Wasps/physiology ; *Moths/parasitology/physiology/growth & development ; China ; *Food Chain ; *Euphorbiaceae/physiology ; *Aphids/physiology/parasitology ; Host-Parasite Interactions ; Herbivory ; Female ; Larva/growth & development/physiology/parasitology ; },
abstract = {Invasive plants from their native and introduced ranges differ in their interactions with herbivores but it is not known whether they also vary in their interactions with herbivore natural enemies. Here, we used olfactometer bioassays and cage experiments to investigate how foraging behaviors of 2 parasitoid and 1 hyperparasitoid species depended on plant population origin. Triadica sebifera (Euphorbiaceae) is native to China but invasive in the United States. In China, it is fed on by a specialist noctuid Gadirtha fusca (Lepidoptera: Nolidae), which hosts a parasitoid Apanteles sp. (Hymenoptera: Microgastinae) and hyperparasitoid (Hymenoptera: Eurytomidae) plus a generalist aphid Toxoptera odinae (Homoptera: Aphidiidae) parasitized by Lysiphlebus confusus (Hymenoptera: Aphidiinae). Both parasitoids preferred plants infested by their host over herbivore-free plants in olfactometer bioassays. Apanteles sp. and Eurytomid wasps preferred G. fusca infested plants from China populations over those from US populations in olfactometer bioassays but L. confusus wasps did not discriminate between T. odinae infested plants from China vs. US populations. Similarly, G. fusca caterpillars on China population plants were more likely to be parasitized than ones on US population plants when they were in the same cage but odds of parasitism for T. odinae did not differ for those on China vs. US population plants. These results suggest that populations from the native and introduced ranges may differ in traits that impact higher trophic levels. This may have implications for successful control of invasive plants as biocontrol agents are introduced or herbivores begin to feed on them in their introduced ranges.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Introduced Species
*Wasps/physiology
*Moths/parasitology/physiology/growth & development
China
*Food Chain
*Euphorbiaceae/physiology
*Aphids/physiology/parasitology
Host-Parasite Interactions
Herbivory
Female
Larva/growth & development/physiology/parasitology
RevDate: 2026-03-11
CmpDate: 2026-03-11
Assessment of spilled toxic bait by wild pigs and potential risk to non-target species.
Pest management science, 79(11):4589-4598.
BACKGROUND: In 2018, a sodium nitrite (SN)-based toxic bait for invasive wild pigs (hereafter wild pigs; Sus scrofa), was evaluated to determine its effectiveness in reducing local wild pig populations in Texas. Localized population reductions of >70% were achieved, but spillage of bait outside wild pig-specific feeders (bait stations) caused by feeding wild pigs resulted in the deaths of non-target animals. To evaluate risks to non-target animals, we tested whether bait presentation influenced the total amount of bait spilled by wild pigs and estimated the associated risk to non-target species.
RESULTS: We found that bait spilled outside bait stations could be reduced by >90% when compacted in trays, as opposed to being manually crumbled into pieces. We documented a mean spill rate of 0.913 g of bait per wild pig. Conservative risk assessments for nine non-target species for which SN toxicity data exist indicate that there is relatively low risk of lethal exposure, apart from zebra finches (Taeniopygia guttata) and white mice. Our results indicate that there may be enough spilled bait per feeding wild pig to kill 9.5 or 3.5 individuals of these species, respectively. Other species assessed range from 0.002 to 0.406 potential mortalities per wild pig.
CONCLUSION: We demonstrated that the amount of bait spilled by wild pigs during feeding and the associated risk to non-target animals can be minimized by presenting the bait compacted in trays within bait stations. We recommend that baits be tightly compacted and secured in bait stations to minimize risks to non-target animals from spilled bait by wild pigs. © 2023 Society of Chemical Industry. This article has been contributed to by U.S. Government employees and their work is in the public domain in the USA.
Additional Links: PMID-37431651
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37431651,
year = {2023},
author = {Kinsey, JC and Foster, JA and Snow, NP and Wishart, JD and Staples, LD and Bush, JK and VerCauteren, KC},
title = {Assessment of spilled toxic bait by wild pigs and potential risk to non-target species.},
journal = {Pest management science},
volume = {79},
number = {11},
pages = {4589-4598},
doi = {10.1002/ps.7658},
pmid = {37431651},
issn = {1526-4998},
support = {//Animal Control Technologies Australia/ ; //Texas Parks and Wildlife Department/ ; //U.S. Department of Agriculture/ ; },
mesh = {Animals ; *Sus scrofa ; *Sodium Nitrite/toxicity ; Texas ; Risk Assessment ; Introduced Species ; Animals, Wild ; Swine ; },
abstract = {BACKGROUND: In 2018, a sodium nitrite (SN)-based toxic bait for invasive wild pigs (hereafter wild pigs; Sus scrofa), was evaluated to determine its effectiveness in reducing local wild pig populations in Texas. Localized population reductions of >70% were achieved, but spillage of bait outside wild pig-specific feeders (bait stations) caused by feeding wild pigs resulted in the deaths of non-target animals. To evaluate risks to non-target animals, we tested whether bait presentation influenced the total amount of bait spilled by wild pigs and estimated the associated risk to non-target species.
RESULTS: We found that bait spilled outside bait stations could be reduced by >90% when compacted in trays, as opposed to being manually crumbled into pieces. We documented a mean spill rate of 0.913 g of bait per wild pig. Conservative risk assessments for nine non-target species for which SN toxicity data exist indicate that there is relatively low risk of lethal exposure, apart from zebra finches (Taeniopygia guttata) and white mice. Our results indicate that there may be enough spilled bait per feeding wild pig to kill 9.5 or 3.5 individuals of these species, respectively. Other species assessed range from 0.002 to 0.406 potential mortalities per wild pig.
CONCLUSION: We demonstrated that the amount of bait spilled by wild pigs during feeding and the associated risk to non-target animals can be minimized by presenting the bait compacted in trays within bait stations. We recommend that baits be tightly compacted and secured in bait stations to minimize risks to non-target animals from spilled bait by wild pigs. © 2023 Society of Chemical Industry. This article has been contributed to by U.S. Government employees and their work is in the public domain in the USA.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Sus scrofa
*Sodium Nitrite/toxicity
Texas
Risk Assessment
Introduced Species
Animals, Wild
Swine
RevDate: 2026-03-11
CmpDate: 2026-03-11
Ace and ace-like genes of invasive redlegged earth mite: copy number variation, target-site mutations, and their associations with organophosphate insensitivity.
Pest management science, 79(11):4219-4230.
BACKGROUND: Invasive Australian populations of redlegged earth mite, Halotydeus destructor (Tucker), are evolving increasing organophosphate resistance. In addition to the canonical ace gene, the target gene of organophosphates, the H. destructor genome contains many radiated ace-like genes that vary in copy number and amino acid sequence. In this work, we characterise copy number and target-site mutation variation at the canonical ace and ace-like genes and test for potential associations with organophosphate insensitivity. This was achieved through comparisons of whole-genome pool-seq data from alive and dead mites following organophosphate exposure.
RESULTS: A combination of increased copy number and target-site mutations at the canonical ace was associated with organophosphate insensitivity in H. destructor. Resistant populations were segregating for G119S, A201S, F331Y at the canonical ace. A subset of populations also had copy numbers of canonical ace > 2, which potentially helps overexpress proteins carrying these target-site mutations. Haplotypes possessing different copy numbers and target-site mutations of the canonical ace gene may be under selection across H. destructor populations. We also detected some evidence that increases in copy number of radiated ace-like genes are associated with organophosphate insensitivity, which might suggest potential roles in sequestration or breakdown of organophosphates.
CONCLUSION: Different combinations of target-site mutations and (or) copy number variation in the canonical ace and ace-like genes may provide non-convergent ways for H. destructor to respond to organophosphate selection. However, these changes may only play a partial role in organophosphate insensitivity, which appears to have a polygenic architecture. © 2023 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.
Additional Links: PMID-37332098
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37332098,
year = {2023},
author = {Thia, JA and Umina, PA and Hoffmann, AA},
title = {Ace and ace-like genes of invasive redlegged earth mite: copy number variation, target-site mutations, and their associations with organophosphate insensitivity.},
journal = {Pest management science},
volume = {79},
number = {11},
pages = {4219-4230},
doi = {10.1002/ps.7619},
pmid = {37332098},
issn = {1526-4998},
support = {//Grains Research and Development Corporation/ ; //University of Melbourne/ ; },
mesh = {Animals ; *DNA Copy Number Variations ; *Organophosphates/pharmacology ; Mutation ; *Mites/genetics/drug effects ; *Acaricides/pharmacology ; *Insecticide Resistance/genetics ; Introduced Species ; },
abstract = {BACKGROUND: Invasive Australian populations of redlegged earth mite, Halotydeus destructor (Tucker), are evolving increasing organophosphate resistance. In addition to the canonical ace gene, the target gene of organophosphates, the H. destructor genome contains many radiated ace-like genes that vary in copy number and amino acid sequence. In this work, we characterise copy number and target-site mutation variation at the canonical ace and ace-like genes and test for potential associations with organophosphate insensitivity. This was achieved through comparisons of whole-genome pool-seq data from alive and dead mites following organophosphate exposure.
RESULTS: A combination of increased copy number and target-site mutations at the canonical ace was associated with organophosphate insensitivity in H. destructor. Resistant populations were segregating for G119S, A201S, F331Y at the canonical ace. A subset of populations also had copy numbers of canonical ace > 2, which potentially helps overexpress proteins carrying these target-site mutations. Haplotypes possessing different copy numbers and target-site mutations of the canonical ace gene may be under selection across H. destructor populations. We also detected some evidence that increases in copy number of radiated ace-like genes are associated with organophosphate insensitivity, which might suggest potential roles in sequestration or breakdown of organophosphates.
CONCLUSION: Different combinations of target-site mutations and (or) copy number variation in the canonical ace and ace-like genes may provide non-convergent ways for H. destructor to respond to organophosphate selection. However, these changes may only play a partial role in organophosphate insensitivity, which appears to have a polygenic architecture. © 2023 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*DNA Copy Number Variations
*Organophosphates/pharmacology
Mutation
*Mites/genetics/drug effects
*Acaricides/pharmacology
*Insecticide Resistance/genetics
Introduced Species
RevDate: 2026-03-09
CmpDate: 2026-03-09
Identification and characterization of a wet adhesive protein extracted from Dreissena bugensis, the freshwater quagga mussel.
Proceedings of the National Academy of Sciences of the United States of America, 123(11):e2537453123.
Mechanisms of wet adhesion have evolved in several aquatic organisms over millions of years. Yet, the repertoire of synthetic biocompatible wet adhesive materials is still limited. The byssus is a well-studied proteinaceous bioadhesive structure utilized by several bivalves to support sessile lifestyles in turbulent conditions. The quagga mussel (Dreissena bugensis) is a freshwater byssate and a notorious invasive species in the Great Lakes region. To identify adhesive proteins in the quagga mussel byssus, we utilized quantitative proteomics and found several proteins enriched at the byssus-substrate interface. Among the identified proteins was the Dbfp7 protein family. Dbfp7 is a small, polymorphic, and mostly disordered protein that lacks significant amounts of 3,4-dihydroxyphenylalanine (DOPA), a modified amino acid found in several marine mussel byssal proteins. Atomic force microscopy nanomechanical mapping of Dbfp7 films demonstrates that this protein exhibits adhesive ability in aqueous conditions. While DOPA is critical for marine mussel adhesion, interfacial electrochemistry of freshwater adhesive plaques suggests that freshwater byssates circumvent catechol-based adhesion. The functional characterization of Dbfp7 as a freshwater mussel adhesive protein advances the understanding of fundamental requirements for biocompatible wet adhesion, a crucial step for the development of bioinspired wet adhesive materials, such as improved medical adhesives.
Additional Links: PMID-41802065
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41802065,
year = {2026},
author = {Obille, AR and Hasan, R and Rees, DJ and Ng, J and Wang, ZY and Bagchi, R and Lian, K and Carneiro, KMM and Sone, ED},
title = {Identification and characterization of a wet adhesive protein extracted from Dreissena bugensis, the freshwater quagga mussel.},
journal = {Proceedings of the National Academy of Sciences of the United States of America},
volume = {123},
number = {11},
pages = {e2537453123},
doi = {10.1073/pnas.2537453123},
pmid = {41802065},
issn = {1091-6490},
support = {RGPIN-2019-06210//Natural Sciences and Engineering Research Council of Canada (NSERC)/ ; RGPIN-2025-07042//Natural Sciences and Engineering Research Council of Canada (NSERC)/ ; },
mesh = {Animals ; *Proteins/chemistry/isolation & purification/metabolism ; *Dreissena/chemistry/metabolism ; Fresh Water ; *Adhesives/chemistry ; Proteomics ; Microscopy, Atomic Force ; Dihydroxyphenylalanine/chemistry ; Adhesiveness ; Bivalvia ; },
abstract = {Mechanisms of wet adhesion have evolved in several aquatic organisms over millions of years. Yet, the repertoire of synthetic biocompatible wet adhesive materials is still limited. The byssus is a well-studied proteinaceous bioadhesive structure utilized by several bivalves to support sessile lifestyles in turbulent conditions. The quagga mussel (Dreissena bugensis) is a freshwater byssate and a notorious invasive species in the Great Lakes region. To identify adhesive proteins in the quagga mussel byssus, we utilized quantitative proteomics and found several proteins enriched at the byssus-substrate interface. Among the identified proteins was the Dbfp7 protein family. Dbfp7 is a small, polymorphic, and mostly disordered protein that lacks significant amounts of 3,4-dihydroxyphenylalanine (DOPA), a modified amino acid found in several marine mussel byssal proteins. Atomic force microscopy nanomechanical mapping of Dbfp7 films demonstrates that this protein exhibits adhesive ability in aqueous conditions. While DOPA is critical for marine mussel adhesion, interfacial electrochemistry of freshwater adhesive plaques suggests that freshwater byssates circumvent catechol-based adhesion. The functional characterization of Dbfp7 as a freshwater mussel adhesive protein advances the understanding of fundamental requirements for biocompatible wet adhesion, a crucial step for the development of bioinspired wet adhesive materials, such as improved medical adhesives.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Proteins/chemistry/isolation & purification/metabolism
*Dreissena/chemistry/metabolism
Fresh Water
*Adhesives/chemistry
Proteomics
Microscopy, Atomic Force
Dihydroxyphenylalanine/chemistry
Adhesiveness
Bivalvia
RevDate: 2026-03-10
CmpDate: 2026-03-10
Abiotic and biotic controls of non-native perennial plant success in drylands.
Nature ecology & evolution, 10(3):523-535.
Drivers of non-native plant success in drylands are poorly understood. Here we identify functional differences between dryland native and non-native perennial plants and assess how biotic, abiotic and anthropogenic factors shape the success of the latter. On the basis of plant community and functional trait data from 98 sites across 25 countries, we report a total of 41 non-native plant species at 31 sites. Non-natives tend towards faster growth strategies than natives. Non-native plant richness is higher at sites with greater grazing pressure and under environmental conditions associated with higher soil fertility, decomposition and fungal richness-conditions that tend to occur in less arid regions-and lower where native plant and herbivore richness are greater. Non-native plant cover correlates positively with grazing pressure and negatively with native plant richness. Taken together, our results suggest that non-native plant success in drylands is facilitated when high grazing pressure coincides with elevated resource availability. Such context-dependence of non-native plant success and linkages with native plant and herbivore diversity highlight the need for managing grazing and conserving biodiversity across the world's drylands.
Additional Links: PMID-41652005
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41652005,
year = {2026},
author = {Rahmanian, S and Eisenhauer, N and Huang, Y and Hejda, M and Pyšek, P and Feilhauer, H and Eldridge, DJ and Gross, N and Le Bagousse-Pinguet, Y and Saiz, H and Delgado-Baquerizo, M and Berdugo, M and Ochoa, V and Gozalo, B and Asensio, S and Guirado, E and Valencia, E and García-Gómez, M and Gaitán, JJ and Mendoza, B and Plaza, C and Díaz-Martínez, P and Martínez-Valderrama, J and Abedi, M and Ahmadian, N and Ahumada, RJ and Amghar, F and Araújo, T and Arroyo, AI and Ben Salem, F and Blaum, N and Boldbat, E and Boldgiv, B and Bowker, M and van den Brink, L and Bu, C and Canessa, R and Castillo-Monroy, AP and Castro, H and Castro-Quezada, P and Chaieb, G and Chibani, R and Conceição, AA and Davila, YC and Deák, B and Donoso, DA and Dougill, A and Espinosa, CI and Fajardo, A and Farzam, M and Ferrante, D and Franzese, J and Fraser, LH and Geiger, E and Gonzalez, SL and Montalván, EG and Hering, R and Marais, E and Hernández Hernández, RM and Hernández-Valdez, SD and Hölzel, N and Huber-Sannwald, E and Jadán, O and Jentsch, A and Kindermann, L and Köbel, M and le Roux, PC and Leder, CV and Li, X and Liancourt, P and Linstädter, A and Liu, J and Louw, MA and Maggs-Kölling, G and Makhalanyane, TP and Issa, OM and Manzaneda, AJ and Margerie, P and Martin, R and McClaran, MP and Messeder, JVS and Mora, JP and Moreno, G and Munson, SM and Nair, GR and Nunes, A and Oliva, G and Palpurina, S and Peter, G and Pueyo, Y and Quiroga, E and Reed, SC and Rey, PJ and Rodríguez, A and Rolo, V and Ruppert, JC and Salah, A and Sarig, S and Singh, BK and Swemmer, A and Teixido, AL and Thomas, AD and Tielbörger, K and Travers, S and Valkó, O and Wamiti, W and Wang, D and Wang, L and Wardle, GM and Wolff, P and Yahdjian, L and Oñatibia, GR and Yari, R and Zaady, E and Zhang, Y and Zhou, X and Maestre, FT},
title = {Abiotic and biotic controls of non-native perennial plant success in drylands.},
journal = {Nature ecology & evolution},
volume = {10},
number = {3},
pages = {523-535},
pmid = {41652005},
issn = {2397-334X},
support = {346001466//Alexander von Humboldt-Stiftung (Alexander von Humboldt Foundation)/ ; [German Research Foundation, DFG]-FZT 118, 202548816)//Deutsche Forschungsgemeinschaft (German Research Foundation)/ ; Ei 862/29-1; FOR 5000, 422440326//Deutsche Forschungsgemeinschaft (German Research Foundation)/ ; ([German Research Foundation, DFG]-FZT 118, 202548816//Deutsche Forschungsgemeinschaft (German Research Foundation)/ ; DFG (Ei 862/29-1; FOR 5000, 422440326//Deutsche Forschungsgemeinschaft (German Research Foundation)/ ; RVO 67985939//Akademie Věd České Republiky (Academy of Sciences of the Czech Republic)/ ; grant no. 41971131//National Natural Science Foundation of China (National Science Foundation of China)/ ; The 111 Project (D23029)//Ministerium für Wissenschaft, Forschung und Kunst Baden-Württemberg (Ministry of Science, Research and Art Baden-Württemberg)/ ; EAR-1554894 and DEB-2406931//National Science Foundation (NSF)/ ; ERC grant 647038 (BIODESERT)//EC | EU Framework Programme for Research and Innovation H2020 | H2020 Priority Excellent Science | H2020 European Research Council (H2020 Excellent Science - European Research Council)/ ; (CIDEGENT/2018/041)//Generalitat Valenciana (Regional Government of Valencia)/ ; },
mesh = {Herbivory ; *Biodiversity ; *Introduced Species ; *Plants/classification ; *Plant Physiological Phenomena ; },
abstract = {Drivers of non-native plant success in drylands are poorly understood. Here we identify functional differences between dryland native and non-native perennial plants and assess how biotic, abiotic and anthropogenic factors shape the success of the latter. On the basis of plant community and functional trait data from 98 sites across 25 countries, we report a total of 41 non-native plant species at 31 sites. Non-natives tend towards faster growth strategies than natives. Non-native plant richness is higher at sites with greater grazing pressure and under environmental conditions associated with higher soil fertility, decomposition and fungal richness-conditions that tend to occur in less arid regions-and lower where native plant and herbivore richness are greater. Non-native plant cover correlates positively with grazing pressure and negatively with native plant richness. Taken together, our results suggest that non-native plant success in drylands is facilitated when high grazing pressure coincides with elevated resource availability. Such context-dependence of non-native plant success and linkages with native plant and herbivore diversity highlight the need for managing grazing and conserving biodiversity across the world's drylands.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Herbivory
*Biodiversity
*Introduced Species
*Plants/classification
*Plant Physiological Phenomena
RevDate: 2026-03-10
CmpDate: 2026-03-10
The role of intraspecific crop-weed hybridization in the evolution of weediness and invasiveness: Cultivated and weedy radish (Raphanus sativus) as a case study.
American journal of botany, 110(9):e16217.
PREMISE: The phenotype of hybrids between a crop and its wild or weed counterpart is usually intermediate and maladapted compared to that of their parents; however, hybridization has sometimes been associated with increased fitness, potentially leading to enhanced weediness and invasiveness. Since the ecological context and maternal genetic effects may affect hybrid fitness, they could influence the evolutionary outcomes of hybridization. Here, we evaluated the performance of first-generation crop-weed hybrids of Raphanus sativus and their parents in two contrasting ecological conditions.
METHODS: Using experimental hybridization and outdoor common garden experiments, we assessed differences in time to flowering, survival to maturity, plant biomass, and reproductive components between bidirectional crop-weed hybrids and their parents in agrestal (wheat cultivation, fertilization, weeding) and ruderal (human-disturbed, uncultivated area) conditions over 2 years.
RESULTS: Crop, weeds, and bidirectional hybrids overlapped at least partially during the flowering period, indicating a high probability of gene flow. Hybrids survived to maturity at rates at least as successful as their parents and had higher plant biomass and fecundity, which resulted in higher fitness compared to their parents in both environments, without any differences associated with the direction of the hybridization.
CONCLUSIONS: Intraspecific crop-weed hybridization, regardless of the cross direction, has the potential to promote weediness in weedy R. sativus in agrestal and ruderal environments, increasing the chances for introgression of crop alleles into weed populations. This is the first report of intraspecific crop-weed hybridization in R. sativus.
Additional Links: PMID-37659092
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37659092,
year = {2023},
author = {Vercellino, RB and Hernández, F and Presotto, A},
title = {The role of intraspecific crop-weed hybridization in the evolution of weediness and invasiveness: Cultivated and weedy radish (Raphanus sativus) as a case study.},
journal = {American journal of botany},
volume = {110},
number = {9},
pages = {e16217},
doi = {10.1002/ajb2.16217},
pmid = {37659092},
issn = {1537-2197},
mesh = {*Raphanus/genetics/physiology/growth & development ; *Hybridization, Genetic ; *Plant Weeds/genetics/physiology ; *Crops, Agricultural/genetics/physiology ; Introduced Species ; *Biological Evolution ; Biomass ; },
abstract = {PREMISE: The phenotype of hybrids between a crop and its wild or weed counterpart is usually intermediate and maladapted compared to that of their parents; however, hybridization has sometimes been associated with increased fitness, potentially leading to enhanced weediness and invasiveness. Since the ecological context and maternal genetic effects may affect hybrid fitness, they could influence the evolutionary outcomes of hybridization. Here, we evaluated the performance of first-generation crop-weed hybrids of Raphanus sativus and their parents in two contrasting ecological conditions.
METHODS: Using experimental hybridization and outdoor common garden experiments, we assessed differences in time to flowering, survival to maturity, plant biomass, and reproductive components between bidirectional crop-weed hybrids and their parents in agrestal (wheat cultivation, fertilization, weeding) and ruderal (human-disturbed, uncultivated area) conditions over 2 years.
RESULTS: Crop, weeds, and bidirectional hybrids overlapped at least partially during the flowering period, indicating a high probability of gene flow. Hybrids survived to maturity at rates at least as successful as their parents and had higher plant biomass and fecundity, which resulted in higher fitness compared to their parents in both environments, without any differences associated with the direction of the hybridization.
CONCLUSIONS: Intraspecific crop-weed hybridization, regardless of the cross direction, has the potential to promote weediness in weedy R. sativus in agrestal and ruderal environments, increasing the chances for introgression of crop alleles into weed populations. This is the first report of intraspecific crop-weed hybridization in R. sativus.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Raphanus/genetics/physiology/growth & development
*Hybridization, Genetic
*Plant Weeds/genetics/physiology
*Crops, Agricultural/genetics/physiology
Introduced Species
*Biological Evolution
Biomass
RevDate: 2026-03-10
CmpDate: 2026-03-10
Modelled dispersal pathways of non-indigenous species in the Danish Wadden Sea.
Marine environmental research, 191:106111.
The introduction-rate of non-indigenous species (NIS) to coastal water bodies has accelerated over the last century. We present a model study assessing the fate of NIS released in likely point sources of the Danish Wadden Sea. We show that NIS-particles released in the deep North Sea are generally transported away from the Wadden Sea, while those released in the coastal North Sea and the Wadden Sea show large variability in track pattern and settlement location. Consequently, the introduction of NIS from ships entering the port of Esbjerg pose a threat to the Wadden Sea through primary and secondary spreading, while transport of species from sources in the south likely causes a slow and steady settling of NIS in the Wadden Sea and coastal North Sea. The study points to the importance of enforcing an efficient monitoring system to ensure early detection of changes to the species composition of the Wadden Sea.
Additional Links: PMID-37573739
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid37573739,
year = {2023},
author = {Schourup-Kristensen, V and Larsen, J and Stæhr, PAU and Maar, M},
title = {Modelled dispersal pathways of non-indigenous species in the Danish Wadden Sea.},
journal = {Marine environmental research},
volume = {191},
number = {},
pages = {106111},
doi = {10.1016/j.marenvres.2023.106111},
pmid = {37573739},
issn = {1879-0291},
mesh = {Denmark ; *Introduced Species ; *Environmental Monitoring/methods ; *Models, Theoretical ; Animals ; North Sea ; *Aquatic Organisms/physiology ; *Animal Distribution ; Models, Biological ; },
abstract = {The introduction-rate of non-indigenous species (NIS) to coastal water bodies has accelerated over the last century. We present a model study assessing the fate of NIS released in likely point sources of the Danish Wadden Sea. We show that NIS-particles released in the deep North Sea are generally transported away from the Wadden Sea, while those released in the coastal North Sea and the Wadden Sea show large variability in track pattern and settlement location. Consequently, the introduction of NIS from ships entering the port of Esbjerg pose a threat to the Wadden Sea through primary and secondary spreading, while transport of species from sources in the south likely causes a slow and steady settling of NIS in the Wadden Sea and coastal North Sea. The study points to the importance of enforcing an efficient monitoring system to ensure early detection of changes to the species composition of the Wadden Sea.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Denmark
*Introduced Species
*Environmental Monitoring/methods
*Models, Theoretical
Animals
North Sea
*Aquatic Organisms/physiology
*Animal Distribution
Models, Biological
RevDate: 2026-03-09
CmpDate: 2026-03-09
A Global Conservation Blind Spot: Neglect of Bryophytes Undermines Biodiversity Targets.
Global change biology, 32(3):e70789.
The global biodiversity crisis is unevenly documented, with conservation assessments heavily biased toward vertebrates and flowering plants. Terrestrial gametophyte-dominant plants (i.e., bryophytes), with over 20,000 species and representing one of Earth's oldest radiations, remain among the most overlooked. To quantify this gap, we integrated global distribution records, elevation patterns, IUCN datasets, research trends, and threat meta-analyzes. Thirty-seven bryophyte-rich regions and global elevational patterns were identified. We found only 1.5% of bryophyte species have been assessed by the IUCN Red List, and among these assessed species, over half are threatened, nearly twice the global average for plants. Agriculture and climate change emerged as the dominant extinction drivers worldwide, while threats vary regionally: deforestation threatens bryophyte diversity in Africa and South America, while climate change and invasive species are the primary threats in Europe. Without targeted, region-specific conservation strategies, accelerating bryophyte decline will undermine biodiversity targets and jeopardize essential ecosystem functions.
Additional Links: PMID-41800856
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41800856,
year = {2026},
author = {Yin, X and Liu, Y and Kong, F and Shu, L and Peng, C and Ang, LP},
title = {A Global Conservation Blind Spot: Neglect of Bryophytes Undermines Biodiversity Targets.},
journal = {Global change biology},
volume = {32},
number = {3},
pages = {e70789},
doi = {10.1111/gcb.70789},
pmid = {41800856},
issn = {1365-2486},
support = {2023JBGS05//Research Project of Baishanzu National Park/ ; 46623-1//Rufford Foundation/ ; },
mesh = {*Biodiversity ; *Conservation of Natural Resources ; *Bryophyta/physiology ; Climate Change ; },
abstract = {The global biodiversity crisis is unevenly documented, with conservation assessments heavily biased toward vertebrates and flowering plants. Terrestrial gametophyte-dominant plants (i.e., bryophytes), with over 20,000 species and representing one of Earth's oldest radiations, remain among the most overlooked. To quantify this gap, we integrated global distribution records, elevation patterns, IUCN datasets, research trends, and threat meta-analyzes. Thirty-seven bryophyte-rich regions and global elevational patterns were identified. We found only 1.5% of bryophyte species have been assessed by the IUCN Red List, and among these assessed species, over half are threatened, nearly twice the global average for plants. Agriculture and climate change emerged as the dominant extinction drivers worldwide, while threats vary regionally: deforestation threatens bryophyte diversity in Africa and South America, while climate change and invasive species are the primary threats in Europe. Without targeted, region-specific conservation strategies, accelerating bryophyte decline will undermine biodiversity targets and jeopardize essential ecosystem functions.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Biodiversity
*Conservation of Natural Resources
*Bryophyta/physiology
Climate Change
RevDate: 2026-03-09
CmpDate: 2026-03-09
Commercial resource potential of an invasive sea cucumber: nutritional analysis of Synaptula reciprocans.
PeerJ, 14:e20466.
BACKGROUND: Synaptula reciprocans, originally native to the Indo-Pacific region, is widespread in the Red Sea. The species entered the Mediterranean during the 1970s and 1980s and has been reported along the Turkish coastline since 2003, where it has established invasive populations. European Union Regulation No. 1143/2014 encourages the investigation of alternative uses and the assessment of the economic potential of invasive species as part of management and control strategies. This study aims to evaluate the nutritional value and elemental composition of S. reciprocans, an invasive species in the Mediterranean, in order to assess its suitability for human consumption and potential alternative applications.
METHODS: S. reciprocans were sampled from two different stations (L1: Gokova Bay and L2: Gulluk Bay) over two seasons, as winter (S1) and summer (S2), and transported to the laboratory under cold chain conditions (+4 °C). Moisture, ash, crude protein, crude fat, fatty acid, amino acid, and elemental content analyses were performed using standardized methods, including gravimetric, Kjeldahl, GC/MS, LC/MS-MS, and ICP-OES techniques.
RESULTS: The findings indicate that both locality and season significantly influence the species' nutritional properties (p < 0.05). Dry matter content exhibited considerable variation across seasons, with the highest concentration observed in L2/S2 and L2/S1. Crude protein levels peaked in winter across both regions (L2S1, L1S1), while fat content was consistently higher in Bodrum samples compared to Gokova (p < 0.05). Ash content was highest in Gokova across both seasonal periods (p < 0.05). The fatty acid profile demonstrated notable seasonal and regional differences (p < 0.05), with linoleic acid (C 18:2) emerging as the predominant polyunsaturated ω-6 fatty acid. Additionally, amino acid analysis revealed significant variation (p < 0.05), identifying alanine, asparagine, glutamine, and proline as the dominant amino acids. Elemental analysis highlighted the absence of copper (Cu) in all sampled tissues, while sodium (Na) was consistently the most abundant mineral.
Additional Links: PMID-41800122
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41800122,
year = {2026},
author = {Ciftcioglu, M and Kesbiç, OS and Filiz, H and Ağdamar, S},
title = {Commercial resource potential of an invasive sea cucumber: nutritional analysis of Synaptula reciprocans.},
journal = {PeerJ},
volume = {14},
number = {},
pages = {e20466},
pmid = {41800122},
issn = {2167-8359},
mesh = {Animals ; *Nutritive Value ; *Introduced Species ; *Sea Cucumbers/chemistry ; Seasons ; Fatty Acids/analysis ; Amino Acids/analysis ; Mediterranean Sea ; },
abstract = {BACKGROUND: Synaptula reciprocans, originally native to the Indo-Pacific region, is widespread in the Red Sea. The species entered the Mediterranean during the 1970s and 1980s and has been reported along the Turkish coastline since 2003, where it has established invasive populations. European Union Regulation No. 1143/2014 encourages the investigation of alternative uses and the assessment of the economic potential of invasive species as part of management and control strategies. This study aims to evaluate the nutritional value and elemental composition of S. reciprocans, an invasive species in the Mediterranean, in order to assess its suitability for human consumption and potential alternative applications.
METHODS: S. reciprocans were sampled from two different stations (L1: Gokova Bay and L2: Gulluk Bay) over two seasons, as winter (S1) and summer (S2), and transported to the laboratory under cold chain conditions (+4 °C). Moisture, ash, crude protein, crude fat, fatty acid, amino acid, and elemental content analyses were performed using standardized methods, including gravimetric, Kjeldahl, GC/MS, LC/MS-MS, and ICP-OES techniques.
RESULTS: The findings indicate that both locality and season significantly influence the species' nutritional properties (p < 0.05). Dry matter content exhibited considerable variation across seasons, with the highest concentration observed in L2/S2 and L2/S1. Crude protein levels peaked in winter across both regions (L2S1, L1S1), while fat content was consistently higher in Bodrum samples compared to Gokova (p < 0.05). Ash content was highest in Gokova across both seasonal periods (p < 0.05). The fatty acid profile demonstrated notable seasonal and regional differences (p < 0.05), with linoleic acid (C 18:2) emerging as the predominant polyunsaturated ω-6 fatty acid. Additionally, amino acid analysis revealed significant variation (p < 0.05), identifying alanine, asparagine, glutamine, and proline as the dominant amino acids. Elemental analysis highlighted the absence of copper (Cu) in all sampled tissues, while sodium (Na) was consistently the most abundant mineral.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Nutritive Value
*Introduced Species
*Sea Cucumbers/chemistry
Seasons
Fatty Acids/analysis
Amino Acids/analysis
Mediterranean Sea
RevDate: 2026-03-09
CmpDate: 2026-03-09
Integrating landscape ecology into generic surveillance plans for bark- and wood-boring beetles.
Ecological applications : a publication of the Ecological Society of America, 36(2):e70194.
International trade poses a growing threat to global biosecurity, with bark- and wood-boring beetles representing a major concern for forest health. Non-native species are frequently introduced at points of entry, where populations can establish in the surrounding landscape. To improve early detection, generic surveillance programs use traps in these high-risk areas, collecting a broad spectrum of species. These traps also capture native beetles, providing insights into the potential species pool that could become exotic elsewhere. However, implementing effective landscape-wide surveillance within reasonable resource limits remains challenging. In this study, we used trapping data of Cerambycidae and Scolytinae from 11 high-risk areas across Europe and North America to develop practical recommendations for generic surveillance at multiple spatial scales. Specifically, we attempted to address two key questions: (1) how to maximize the single-trap efficacy depending on the trap surroundings; and (2) how many traps should be used in a landscape-wide sampling depending on landscape composition. Under budget constraints, we recommend prioritizing trap placement within forest patches and avoiding locations surrounded by roads or buildings. Urban-dominated landscapes required greater sampling effort (i.e., more traps) than forest-dominated landscapes. Deploying fewer than four traps per square kilometer might lead to an incomplete representation of the local bark- and wood-boring beetle community, losing about 30%-50% of species. Overall, our findings highlight the importance of incorporating landscape ecology into generic surveillance planning to optimize trap effectiveness within resource limitations.
Additional Links: PMID-41797626
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41797626,
year = {2026},
author = {Nardi, D and Rassati, D and Battisti, A and Branco, M and Courtin, C and Faccoli, M and Feddern, N and Francese, JA and Franzen, E and Garcia, A and Giannone, F and Gossner, MM and Jonsell, M and Kostanowicz, C and Marchioro, M and Martinek, P and Ray, AM and Roques, A and Sweeney, J and Van Rooyen, K and Webster, V and Marini, L},
title = {Integrating landscape ecology into generic surveillance plans for bark- and wood-boring beetles.},
journal = {Ecological applications : a publication of the Ecological Society of America},
volume = {36},
number = {2},
pages = {e70194},
doi = {10.1002/eap.70194},
pmid = {41797626},
issn = {1051-0761},
support = {AP18PPQS&T00C164//Animal and Plant Health Inspection Service/ ; AP18PPQS&T00C169//Animal and Plant Health Inspection Service/ ; AP19PPQS&T00C082//Animal and Plant Health Inspection Service/ ; 771271//Horizon 2020 Framework Programme/ ; UID/00239//Fundação para a Ciência e a Tecnologia/ ; //Canadian Forest Service, Forest Pest Risk Management Program/ ; 101134200//HORIZON EUROPE Climate, Energy and Mobility/ ; },
mesh = {Animals ; *Coleoptera/physiology ; Wood ; *Environmental Monitoring/methods ; *Ecosystem ; Forests ; },
abstract = {International trade poses a growing threat to global biosecurity, with bark- and wood-boring beetles representing a major concern for forest health. Non-native species are frequently introduced at points of entry, where populations can establish in the surrounding landscape. To improve early detection, generic surveillance programs use traps in these high-risk areas, collecting a broad spectrum of species. These traps also capture native beetles, providing insights into the potential species pool that could become exotic elsewhere. However, implementing effective landscape-wide surveillance within reasonable resource limits remains challenging. In this study, we used trapping data of Cerambycidae and Scolytinae from 11 high-risk areas across Europe and North America to develop practical recommendations for generic surveillance at multiple spatial scales. Specifically, we attempted to address two key questions: (1) how to maximize the single-trap efficacy depending on the trap surroundings; and (2) how many traps should be used in a landscape-wide sampling depending on landscape composition. Under budget constraints, we recommend prioritizing trap placement within forest patches and avoiding locations surrounded by roads or buildings. Urban-dominated landscapes required greater sampling effort (i.e., more traps) than forest-dominated landscapes. Deploying fewer than four traps per square kilometer might lead to an incomplete representation of the local bark- and wood-boring beetle community, losing about 30%-50% of species. Overall, our findings highlight the importance of incorporating landscape ecology into generic surveillance planning to optimize trap effectiveness within resource limitations.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Coleoptera/physiology
Wood
*Environmental Monitoring/methods
*Ecosystem
Forests
RevDate: 2026-03-09
CmpDate: 2026-03-09
Faecal DNA detection and molecular identification of nematodes of veterinary relevance in invasive raccoons and raccoon dogs in Central Europe.
Veterinary parasitology, 343:110727.
Invasive carnivores such as the raccoon (Procyon lotor) and raccoon dog (Nyctereutes procyonoides) are widespread in Europe and may contribute to the circulation of nematodes of veterinary and zoonotic relevance at the wildlife-domestic animal interface. Molecular data on nematode taxa infecting these hosts in Central Europe remain scarce, particularly those derived from faecal DNA. We analysed 212 post-mortem faecal samples collected in western Poland (97 raccoons, 115 raccoon dogs) using PCR-based screening followed by mitochondrial cytochrome c oxidase subunit 1 (cox1) sequencing for molecular identification and phylogenetic analysis. Nematode DNA was detected in 46/212 samples (21.7%), representing minimum detection frequencies rather than true prevalence. In raccoon dogs, sequences of Uncinaria stenocephala, Toxocara canis and Crenosoma spp. were identified, with Molineus sp. representing the most frequently detected taxon. In raccoons, cox1 sequences indicated Strongyloides sp., T. canis and Molineus sp., together with several lineages that could not be reliably assigned due to limited representation of wildlife-associated nematodes in public databases. DNA of Baylisascaris procyonis was not detected. Mitochondrial cox1 sequences obtained from morphologically identified adult Molineus specimens were identical to those recovered from faecal samples, providing the first reference sequences for this genus. Overall, this study provides baseline molecular data on nematode taxa circulating in invasive carnivores in Central Europe and demonstrates the utility of faecal DNA for qualitative surveillance of nematodes of veterinary relevance.
Additional Links: PMID-41762534
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41762534,
year = {2026},
author = {Buńkowska-Gawlik, K and Hildebrand, J and Popiołek, M and Perec-Matysiak, A},
title = {Faecal DNA detection and molecular identification of nematodes of veterinary relevance in invasive raccoons and raccoon dogs in Central Europe.},
journal = {Veterinary parasitology},
volume = {343},
number = {},
pages = {110727},
doi = {10.1016/j.vetpar.2026.110727},
pmid = {41762534},
issn = {1873-2550},
mesh = {Animals ; *Raccoons/parasitology ; *Feces/parasitology ; *Raccoon Dogs/parasitology ; *DNA, Helminth/genetics/isolation & purification ; Poland/epidemiology ; Phylogeny ; *Nematode Infections/veterinary/epidemiology/parasitology ; Introduced Species ; *Nematoda/genetics/isolation & purification/classification ; Electron Transport Complex IV/genetics ; },
abstract = {Invasive carnivores such as the raccoon (Procyon lotor) and raccoon dog (Nyctereutes procyonoides) are widespread in Europe and may contribute to the circulation of nematodes of veterinary and zoonotic relevance at the wildlife-domestic animal interface. Molecular data on nematode taxa infecting these hosts in Central Europe remain scarce, particularly those derived from faecal DNA. We analysed 212 post-mortem faecal samples collected in western Poland (97 raccoons, 115 raccoon dogs) using PCR-based screening followed by mitochondrial cytochrome c oxidase subunit 1 (cox1) sequencing for molecular identification and phylogenetic analysis. Nematode DNA was detected in 46/212 samples (21.7%), representing minimum detection frequencies rather than true prevalence. In raccoon dogs, sequences of Uncinaria stenocephala, Toxocara canis and Crenosoma spp. were identified, with Molineus sp. representing the most frequently detected taxon. In raccoons, cox1 sequences indicated Strongyloides sp., T. canis and Molineus sp., together with several lineages that could not be reliably assigned due to limited representation of wildlife-associated nematodes in public databases. DNA of Baylisascaris procyonis was not detected. Mitochondrial cox1 sequences obtained from morphologically identified adult Molineus specimens were identical to those recovered from faecal samples, providing the first reference sequences for this genus. Overall, this study provides baseline molecular data on nematode taxa circulating in invasive carnivores in Central Europe and demonstrates the utility of faecal DNA for qualitative surveillance of nematodes of veterinary relevance.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Raccoons/parasitology
*Feces/parasitology
*Raccoon Dogs/parasitology
*DNA, Helminth/genetics/isolation & purification
Poland/epidemiology
Phylogeny
*Nematode Infections/veterinary/epidemiology/parasitology
Introduced Species
*Nematoda/genetics/isolation & purification/classification
Electron Transport Complex IV/genetics
RevDate: 2026-03-05
CmpDate: 2026-03-05
Evaluation efficacy of filtration + UV-C radiation for ballast water treatment at different salinity.
Journal of environmental management, 401:128921.
In recent years, the issue of invasive alien species brought on by ballast water has drawn increasing attention, and advances in ballast water treatment technologies have been made. One of the most popular combined ballast water treatment technologies utilized in ballast water management systems globally is filtration + UV-C radiation. In this work, we compared the effectiveness of filtration + UV technology in treating plankton in ballast water with various salinity. The final biological density of ballast water treated by filtration + UV process with different salinity could meet the biological discharge standard required by D-2 standard. UV-C irradiation (It mainly acts on phytoplankton) is more sensitive to salinity than filtration (It mainly acts on phytoplankton).
Additional Links: PMID-41679063
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41679063,
year = {2026},
author = {He, Z and Xue, M and Wang, Y and Tian, Z and Wu, H},
title = {Evaluation efficacy of filtration + UV-C radiation for ballast water treatment at different salinity.},
journal = {Journal of environmental management},
volume = {401},
number = {},
pages = {128921},
doi = {10.1016/j.jenvman.2026.128921},
pmid = {41679063},
issn = {1095-8630},
mesh = {*Ultraviolet Rays ; *Filtration ; Salinity ; *Water Purification/methods ; Phytoplankton/radiation effects ; Ships ; },
abstract = {In recent years, the issue of invasive alien species brought on by ballast water has drawn increasing attention, and advances in ballast water treatment technologies have been made. One of the most popular combined ballast water treatment technologies utilized in ballast water management systems globally is filtration + UV-C radiation. In this work, we compared the effectiveness of filtration + UV technology in treating plankton in ballast water with various salinity. The final biological density of ballast water treated by filtration + UV process with different salinity could meet the biological discharge standard required by D-2 standard. UV-C irradiation (It mainly acts on phytoplankton) is more sensitive to salinity than filtration (It mainly acts on phytoplankton).},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Ultraviolet Rays
*Filtration
Salinity
*Water Purification/methods
Phytoplankton/radiation effects
Ships
RevDate: 2026-03-05
CmpDate: 2026-03-05
Plant-based coagulants for sustainable treatment: Insights from a systematic review and their potential application in Brazil.
Journal of environmental management, 401:128973.
Beyond their well-known role in air purification, plants can also act as natural coagulants for water, wastewater, and effluent treatment. This systematic review examined research on plant-based coagulants published between 2000 and 2024 across four databases (Web of Science, Scopus, ScienceDirect, and Taylor & Francis). Of the 895 retrieved articles, 175 met the eligibility criteria and were analyzed by plant species, preparation method, treatment matrix, application scale, and efficiency. Plant-based coagulants showed broad applicability in effluents, followed by water and wastewater, with high removal efficiencies for turbidity (up to 100%), microbiological parameters (80-98%), heavy metals (78-90%), and emerging contaminants (70-88%). Most studies investigated individual coagulants using simple preparation methods such as drying and grinding, though some species (e.g., Moringa oleifera, Aloe vera) enable even more accessible processing. Research remains largely at the bench-scale, with limited pilot applications, underscoring the need for scale-up and real-world validation. Reported benefits include low toxicity, reduced sludge production, and opportunities for using agricultural residues or invasive species. Despite Brazil's vast biodiversity and technical capacity as a BRICS country, few studies have explored its potential, highlighting the need for targeted research to foster sustainable water treatment solutions. Exploring the viability of plant-based coagulants represents not only a scientific challenge but also a strategic opportunity to advance sustainable, low-cost, and locally driven treatment solutions, particularly for biodiversity-rich countries like Brazil.
Additional Links: PMID-41679052
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41679052,
year = {2026},
author = {Puchalski, BS and da Silveira, MK and Soares, EJS and Gonçalves, IL and Freitas, BLS},
title = {Plant-based coagulants for sustainable treatment: Insights from a systematic review and their potential application in Brazil.},
journal = {Journal of environmental management},
volume = {401},
number = {},
pages = {128973},
doi = {10.1016/j.jenvman.2026.128973},
pmid = {41679052},
issn = {1095-8630},
mesh = {Brazil ; *Water Purification/methods ; Wastewater ; *Waste Disposal, Fluid/methods ; *Plants ; Water Pollutants, Chemical ; },
abstract = {Beyond their well-known role in air purification, plants can also act as natural coagulants for water, wastewater, and effluent treatment. This systematic review examined research on plant-based coagulants published between 2000 and 2024 across four databases (Web of Science, Scopus, ScienceDirect, and Taylor & Francis). Of the 895 retrieved articles, 175 met the eligibility criteria and were analyzed by plant species, preparation method, treatment matrix, application scale, and efficiency. Plant-based coagulants showed broad applicability in effluents, followed by water and wastewater, with high removal efficiencies for turbidity (up to 100%), microbiological parameters (80-98%), heavy metals (78-90%), and emerging contaminants (70-88%). Most studies investigated individual coagulants using simple preparation methods such as drying and grinding, though some species (e.g., Moringa oleifera, Aloe vera) enable even more accessible processing. Research remains largely at the bench-scale, with limited pilot applications, underscoring the need for scale-up and real-world validation. Reported benefits include low toxicity, reduced sludge production, and opportunities for using agricultural residues or invasive species. Despite Brazil's vast biodiversity and technical capacity as a BRICS country, few studies have explored its potential, highlighting the need for targeted research to foster sustainable water treatment solutions. Exploring the viability of plant-based coagulants represents not only a scientific challenge but also a strategic opportunity to advance sustainable, low-cost, and locally driven treatment solutions, particularly for biodiversity-rich countries like Brazil.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Brazil
*Water Purification/methods
Wastewater
*Waste Disposal, Fluid/methods
*Plants
Water Pollutants, Chemical
RevDate: 2026-03-09
CmpDate: 2026-03-09
Invasive Lonicera maackii (Dipscales: Caprifoliaceae) supports a depauperate arthropod community.
Environmental entomology, 55(2):.
Invasion by non-native species is a growing threat to ecosystems and economies. In eastern North American woodlands, invasive exotic shrubs are displacing native plants and transforming understory communities. The displacement of native plants by invasive non-natives may reduce the resources available to higher trophic levels by supporting diminished arthropod communities. Despite a conceptual understanding of the potential for invasive shrubs to transform forest communities, little research has focused on characterizing the arthropod communities they support or their impact on higher trophic levels in eastern North American forests. To address this gap, we compared arthropod diversity, abundance, and community composition on a highly invasive shrub in southwestern Ohio, Amur honeysuckle (Lonicera maackii, Maxim., Dipscales: Caprifoliaceae), to a related, ecologically similar, native shrub, blackhaw (Viburnum prunifolium, Linnaeus, Dipscales: Adoxaceae), over a growing season. Relative to the native shrub, we found that L. maackii hosted a depauperate arthropod community overall, with about 25% fewer individuals and 28% fewer species than its native counterpart, V. prunifolium-primarily driven by a smaller herbivore community on L. maackii. In contrast, the abundance and richness of predatory arthropods were similar between the native and invasive shrubs. The arthropod communities on the native and exotic plants broadly overlapped in ordination space; however, community composition varied significantly, albeit modestly. These findings support the prediction that invasive plants support depauperate arthropod communities and provide reduced ecosystem services.
Additional Links: PMID-41475011
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41475011,
year = {2026},
author = {Zakroff, ARA and Stireman Iii, JO},
title = {Invasive Lonicera maackii (Dipscales: Caprifoliaceae) supports a depauperate arthropod community.},
journal = {Environmental entomology},
volume = {55},
number = {2},
pages = {},
doi = {10.1093/ee/nvaf130},
pmid = {41475011},
issn = {1938-2936},
support = {//WestRock Scholars Program of the College of Science and Mathematics at Wright State University and a Five Rivers MetroParks Foundation Ecological Research/ ; },
mesh = {Animals ; *Introduced Species ; *Lonicera/physiology ; *Arthropods/physiology ; Ohio ; *Biodiversity ; },
abstract = {Invasion by non-native species is a growing threat to ecosystems and economies. In eastern North American woodlands, invasive exotic shrubs are displacing native plants and transforming understory communities. The displacement of native plants by invasive non-natives may reduce the resources available to higher trophic levels by supporting diminished arthropod communities. Despite a conceptual understanding of the potential for invasive shrubs to transform forest communities, little research has focused on characterizing the arthropod communities they support or their impact on higher trophic levels in eastern North American forests. To address this gap, we compared arthropod diversity, abundance, and community composition on a highly invasive shrub in southwestern Ohio, Amur honeysuckle (Lonicera maackii, Maxim., Dipscales: Caprifoliaceae), to a related, ecologically similar, native shrub, blackhaw (Viburnum prunifolium, Linnaeus, Dipscales: Adoxaceae), over a growing season. Relative to the native shrub, we found that L. maackii hosted a depauperate arthropod community overall, with about 25% fewer individuals and 28% fewer species than its native counterpart, V. prunifolium-primarily driven by a smaller herbivore community on L. maackii. In contrast, the abundance and richness of predatory arthropods were similar between the native and invasive shrubs. The arthropod communities on the native and exotic plants broadly overlapped in ordination space; however, community composition varied significantly, albeit modestly. These findings support the prediction that invasive plants support depauperate arthropod communities and provide reduced ecosystem services.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Introduced Species
*Lonicera/physiology
*Arthropods/physiology
Ohio
*Biodiversity
RevDate: 2026-03-05
CmpDate: 2025-09-14
A mechanistic statistical approach to infer invasion characteristics of human-dispersed species with complex life cycle.
Ecological monographs, 95(1):.
The rising introduction of invasive species through trade networks threatens biodiversity and ecosystem services. Yet, we have a limited understanding of how transportation networks determine spatiotemporal patterns of range expansion. This knowledge gap may stem from two reasons. First, current analytical models fail to integrate the invader's life-history dynamics with heterogeneity in human-mediated dispersal patterns. Second, classical statistical methods often fail to provide reliable estimates of model parameters, such as time and place of species introduction and life-history characteristics, due to spatial biases in the presence-only records and lack of informative demographic data. To address these gaps, we first formulate an age-structured metapopulation model that uses a probability matrix to emulate human-mediated dispersal patterns. The model reveals that an invader spreads radially along the shortest network path, such that the inter-patch network distances decrease with increasing traffic volume and reproductive value of hitchhikers. Next, we propose a hierarchical Bayesian statistical method to estimate model parameters using presence-only data and prior demographic knowledge. To show the utility of the statistical approach, we analyze zebra mussel (Dreissena polymorpha) expansion in North America through the inland commercial shipping network. Our analysis suggests that zebra mussels might have been introduced before 1981, indicating a lag of five years between time of introduction and first detection in late 1986. Furthermore, using our statistical model we estimated a one in three chance that they were introduced near Kingsville (Ontario, Canada), where they were first reported. We also find survival, fecundity, and dispersal during early life (1-2 years) play a critical role in determining the expansion success of these mollusks. These results underscore the importance of fusing prior scientific knowledge with observation and demographic processes in a Bayesian framework for conceptual and practical understanding of how invasive species spread by human agency.
Additional Links: PMID-40842822
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid40842822,
year = {2025},
author = {Goel, N and Liebhold, AM and Bertelsmeier, C and Hooten, MB and Korolev, KS and Keitt, TH},
title = {A mechanistic statistical approach to infer invasion characteristics of human-dispersed species with complex life cycle.},
journal = {Ecological monographs},
volume = {95},
number = {1},
pages = {},
pmid = {40842822},
issn = {0012-9615},
support = {R01 GM138530/GM/NIGMS NIH HHS/United States ; },
abstract = {The rising introduction of invasive species through trade networks threatens biodiversity and ecosystem services. Yet, we have a limited understanding of how transportation networks determine spatiotemporal patterns of range expansion. This knowledge gap may stem from two reasons. First, current analytical models fail to integrate the invader's life-history dynamics with heterogeneity in human-mediated dispersal patterns. Second, classical statistical methods often fail to provide reliable estimates of model parameters, such as time and place of species introduction and life-history characteristics, due to spatial biases in the presence-only records and lack of informative demographic data. To address these gaps, we first formulate an age-structured metapopulation model that uses a probability matrix to emulate human-mediated dispersal patterns. The model reveals that an invader spreads radially along the shortest network path, such that the inter-patch network distances decrease with increasing traffic volume and reproductive value of hitchhikers. Next, we propose a hierarchical Bayesian statistical method to estimate model parameters using presence-only data and prior demographic knowledge. To show the utility of the statistical approach, we analyze zebra mussel (Dreissena polymorpha) expansion in North America through the inland commercial shipping network. Our analysis suggests that zebra mussels might have been introduced before 1981, indicating a lag of five years between time of introduction and first detection in late 1986. Furthermore, using our statistical model we estimated a one in three chance that they were introduced near Kingsville (Ontario, Canada), where they were first reported. We also find survival, fecundity, and dispersal during early life (1-2 years) play a critical role in determining the expansion success of these mollusks. These results underscore the importance of fusing prior scientific knowledge with observation and demographic processes in a Bayesian framework for conceptual and practical understanding of how invasive species spread by human agency.},
}
RevDate: 2025-08-26
CmpDate: 2025-08-26
Seven years later: native AMF inoculation improves grassland successional stage, floristic quality index, and diversity, while suppressing weeds.
FEMS microbiology letters, 372:.
Reintroducing key soil microbes, such as arbuscular mycorrhizal (AM) fungi, can enhance prairie restoration, but the long-term persistence of these effects is unclear. In 2017, a tallgrass prairie restoration experiment was established that applied an inoculation gradient of native AM fungal inoculant ranging from 0 to 8192 kg/ha. Here, we sample the resulting prairie community establishment and spread seven growing seasons later (72 months). We found that AM fungal application increased total diversity, floristic quality index, and average coefficient of conservatism scores-metrics that assess an area's ecological integrity based on plant species. Moreover, high application densities of native AM fungi reduced non-native plant abundance. Furthermore, inoculated prairie plots were more likely to extend 1.5 m into adjacent nonseeded old-field plots, enhancing native diversity and reducing invasion in marginal lands. These findings highlight the lasting benefits of native AM fungal inoculation in prairie restoration and their potential to facilitate long-term ecosystem recovery, aligning with global biodiversity conservation efforts such as the UN Sustainable Development Goal 15 (Life on Land). Given that land managers spend ~25% of their time and considerable economic input managing invasive species, these findings demonstrate that the reintroducing native AM fungi from reference ecosystems during grassland restoration could provide a cost-effective means of enhancing ecological outcomes.
Additional Links: PMID-40758403
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid40758403,
year = {2025},
author = {Koziol, L and McKenna, TP and Duell, EB and Bever, JD},
title = {Seven years later: native AMF inoculation improves grassland successional stage, floristic quality index, and diversity, while suppressing weeds.},
journal = {FEMS microbiology letters},
volume = {372},
number = {},
pages = {},
doi = {10.1093/femsle/fnaf079},
pmid = {40758403},
issn = {1574-6968},
support = {DBI-2120153//National Science Foundation/ ; BII-2120153//National Science Foundation/ ; PFI 2016549//National Science Foundation/ ; NIFA-AFRI-1003475//United States Department of Agriculture/ ; },
mesh = {*Grassland ; *Mycorrhizae/physiology ; *Biodiversity ; *Soil Microbiology ; *Plant Weeds/growth & development ; Ecosystem ; },
abstract = {Reintroducing key soil microbes, such as arbuscular mycorrhizal (AM) fungi, can enhance prairie restoration, but the long-term persistence of these effects is unclear. In 2017, a tallgrass prairie restoration experiment was established that applied an inoculation gradient of native AM fungal inoculant ranging from 0 to 8192 kg/ha. Here, we sample the resulting prairie community establishment and spread seven growing seasons later (72 months). We found that AM fungal application increased total diversity, floristic quality index, and average coefficient of conservatism scores-metrics that assess an area's ecological integrity based on plant species. Moreover, high application densities of native AM fungi reduced non-native plant abundance. Furthermore, inoculated prairie plots were more likely to extend 1.5 m into adjacent nonseeded old-field plots, enhancing native diversity and reducing invasion in marginal lands. These findings highlight the lasting benefits of native AM fungal inoculation in prairie restoration and their potential to facilitate long-term ecosystem recovery, aligning with global biodiversity conservation efforts such as the UN Sustainable Development Goal 15 (Life on Land). Given that land managers spend ~25% of their time and considerable economic input managing invasive species, these findings demonstrate that the reintroducing native AM fungi from reference ecosystems during grassland restoration could provide a cost-effective means of enhancing ecological outcomes.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Grassland
*Mycorrhizae/physiology
*Biodiversity
*Soil Microbiology
*Plant Weeds/growth & development
Ecosystem
RevDate: 2025-05-19
CmpDate: 2025-02-08
Urban Greening and Pollen Allergy: Balancing Health and Environmental Sustainability.
The journal of allergy and clinical immunology. In practice, 13(2):275-279.
Urban living requires a careful balance between human health and environmental sustainability when selecting urban vegetation. Public gardens and green roofs offer significant environmental benefits, including air filtration, exposure to health-associated microbiota, and mitigation of the urban heat island effect. However, prioritizing allergy-friendly species is crucial to prevent the exacerbation of pollen allergies. This review highlights 3 primary criteria for selecting vegetation that supports these ecosystem services while minimizing allergy risks. First, reducing the use of many wind-pollinated plants, such as birch trees and grasses, is crucial due to their high pollen production and cross-reactivity with other species, which can exacerbate allergies. In contrast, insect-pollinated plants are generally safer for allergy sufferers. Secondly, cultivating multispecies plant communities with minimal maintenance supports habitats for microbiota and invertebrates, further providing ecosystem services. Lastly, balancing plant gender ratios in urban spaces can help control pollen levels. Together these criteria provide a framework for urban planners to create green spaces that are both environmentally beneficial and allergy friendly. Although this review focuses on European data, the principles discussed have global relevance, reinforcing the need to integrate environmental sustainability with public health considerations in urban planning. Future studies should also investigate the health impacts of plant volatile emissions, explore heat-resistant plant varieties, and assess the ecological risks of invasive species to support sustainable, allergy-friendly urban environments.
Additional Links: PMID-39710225
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid39710225,
year = {2025},
author = {Stevanovic, K and Sinkkonen, A and Pawankar, R and Zuberbier, T},
title = {Urban Greening and Pollen Allergy: Balancing Health and Environmental Sustainability.},
journal = {The journal of allergy and clinical immunology. In practice},
volume = {13},
number = {2},
pages = {275-279},
doi = {10.1016/j.jaip.2024.12.017},
pmid = {39710225},
issn = {2213-2201},
mesh = {Humans ; *Pollen/immunology ; *Rhinitis, Allergic, Seasonal/epidemiology/prevention & control/immunology ; Allergens/immunology ; Ecosystem ; Animals ; },
abstract = {Urban living requires a careful balance between human health and environmental sustainability when selecting urban vegetation. Public gardens and green roofs offer significant environmental benefits, including air filtration, exposure to health-associated microbiota, and mitigation of the urban heat island effect. However, prioritizing allergy-friendly species is crucial to prevent the exacerbation of pollen allergies. This review highlights 3 primary criteria for selecting vegetation that supports these ecosystem services while minimizing allergy risks. First, reducing the use of many wind-pollinated plants, such as birch trees and grasses, is crucial due to their high pollen production and cross-reactivity with other species, which can exacerbate allergies. In contrast, insect-pollinated plants are generally safer for allergy sufferers. Secondly, cultivating multispecies plant communities with minimal maintenance supports habitats for microbiota and invertebrates, further providing ecosystem services. Lastly, balancing plant gender ratios in urban spaces can help control pollen levels. Together these criteria provide a framework for urban planners to create green spaces that are both environmentally beneficial and allergy friendly. Although this review focuses on European data, the principles discussed have global relevance, reinforcing the need to integrate environmental sustainability with public health considerations in urban planning. Future studies should also investigate the health impacts of plant volatile emissions, explore heat-resistant plant varieties, and assess the ecological risks of invasive species to support sustainable, allergy-friendly urban environments.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Humans
*Pollen/immunology
*Rhinitis, Allergic, Seasonal/epidemiology/prevention & control/immunology
Allergens/immunology
Ecosystem
Animals
RevDate: 2019-11-20
First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America.
Plant disease, 94(2):279.
Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana 'Cleveland Select' showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5'-3' ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana 'Chanticleer', in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.
Additional Links: PMID-30754298
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid30754298,
year = {2010},
author = {Minnis, AM and Rossman, AY and Clement, DL and Malinoski, MK and Rane, KK},
title = {First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America.},
journal = {Plant disease},
volume = {94},
number = {2},
pages = {279},
doi = {10.1094/PDIS-94-2-0279B},
pmid = {30754298},
issn = {0191-2917},
abstract = {Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana 'Cleveland Select' showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5'-3' ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana 'Chanticleer', in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.},
}
RevDate: 2026-03-03
Drought and fragmentation shape successional trajectories of isolated urban forests in South Korea.
Scientific reports pii:10.1038/s41598-026-42621-w [Epub ahead of print].
Managing urban forest successional trajectories is essential for sustainable and cost-effective ecological restoration. However, successional pathways in South Korea's urban forests are frequently disrupted by environmental and anthropogenic pressures, threatening their long-term sustainability. This study examined successional pathways and their environmental determinants in isolated urban forest patches across seven metropolitan cities. Structural equation modeling was used to assess relationships among environmental variables, canopy structure, and successional pathways, and key drivers were identified using Random Forest analysis. Overall, 83.2% of plots exhibited progressive succession, transitioning from early-successional invasive alien or introduced species toward mid- to late-successional native communities. In contrast, 16.8% of plots underwent retrogressive succession, characterized by shifts from Quercus-dominated stands toward stress-tolerant, urban-adapted species associated with earlier successional or degraded conditions. Drought severity and forest patch size emerged as the primary determinants of successional pathways. These findings demonstrate how climatic stress and spatial constraints linked to fragmentation shape UF dynamics at a regional scale and provide insights for targeted restoration strategies that promote progressive succession and enhance the long-term sustainability of urban forests.
Additional Links: PMID-41776323
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41776323,
year = {2026},
author = {Kim, I and Sou, HD and Kim, JS and Cho, HJ and Jeong, J and Oh, JH and Park, CR},
title = {Drought and fragmentation shape successional trajectories of isolated urban forests in South Korea.},
journal = {Scientific reports},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41598-026-42621-w},
pmid = {41776323},
issn = {2045-2322},
support = {#FE0100202403//National Institute of Forest Science/ ; #FE0100202403//National Institute of Forest Science/ ; #FE0100202403//National Institute of Forest Science/ ; #FE0100202403//National Institute of Forest Science/ ; #FE0100202403//National Institute of Forest Science/ ; #FE0100202403//National Institute of Forest Science/ ; #FE0100202403//National Institute of Forest Science/ ; },
abstract = {Managing urban forest successional trajectories is essential for sustainable and cost-effective ecological restoration. However, successional pathways in South Korea's urban forests are frequently disrupted by environmental and anthropogenic pressures, threatening their long-term sustainability. This study examined successional pathways and their environmental determinants in isolated urban forest patches across seven metropolitan cities. Structural equation modeling was used to assess relationships among environmental variables, canopy structure, and successional pathways, and key drivers were identified using Random Forest analysis. Overall, 83.2% of plots exhibited progressive succession, transitioning from early-successional invasive alien or introduced species toward mid- to late-successional native communities. In contrast, 16.8% of plots underwent retrogressive succession, characterized by shifts from Quercus-dominated stands toward stress-tolerant, urban-adapted species associated with earlier successional or degraded conditions. Drought severity and forest patch size emerged as the primary determinants of successional pathways. These findings demonstrate how climatic stress and spatial constraints linked to fragmentation shape UF dynamics at a regional scale and provide insights for targeted restoration strategies that promote progressive succession and enhance the long-term sustainability of urban forests.},
}
RevDate: 2026-03-08
CmpDate: 2026-03-08
A scoping literature review on the impacts of non-native species on the native terrestrial biodiversity of an oceanic island.
PeerJ, 14:e20839.
BACKGROUND: Many non-native species have been introduced to oceanic islands, with a subset becoming invasive, which pose the greatest threat to native terrestrial biodiversity. Yet, existing information on their impacts, particularly at the island scale, has rarely been synthesised. Addressing this gap is essential for revealing neglected aspects and for prioritising conservation management to optimise the use of scarce resources. Here, we use one volcanic oceanic island as a model to characterise the knowledge landscape about the impacts of non-native species on native biodiversity. Specifically, we (1) inventory the studied mechanisms through which non-native species affect native biodiversity; (2) evaluate the extent to which studies assess impacts at the level of biological organisation and/or biotic interactions; (3) assess the severity of impacts of non-native taxa and (4) highlight research gaps requiring most attention at the island scale.
METHOD: Mauritius was used for a scoping review based on four databases (Dimensions, Google Scholar, ScienceDirect and SpringerLink) to systematically search and identify relevant studies on the impacts of non-native species on native terrestrial biodiversity. We used the Environmental Impact Classification for Alien Taxa (EICAT) framework and its extension, EICAT+ to categorise the impact mechanisms and magnitude of impact. We searched for all records from the inception of each database until November 2023. We included 62 publications in the final analysis, selected from a total of 1,760 articles screened following the PRISMA guidelines for scoping reviews.
RESULTS: We recorded a total of 273 impact records between non-native and native species. Non-native species of plants and mammals were the most common, affecting a wide range of native taxonomic groups. Negative impacts predominated (65.2%), followed by positive impacts (34.1%), with few neutral impacts (0.7%). Competition and predation were the most studied negative impact mechanisms, typically impacting many native species while positive impacts of non-native species were mainly associated with the provision of trophic resources and typically impacted few species. The main impacts of non-native species on native species studied were at the level of biological organisation (N = 169), while only 22 of the impact records investigated their effects on biotic interactions.
CONCLUSION: Limited attention has been given to indirect mechanisms and the impacts of non-native species on biotic interactions. Future studies should prioritise these areas, as indirect mechanisms may reveal cumulative and often insidious pathways through which non-native species accelerate biodiversity loss, especially on islands. Investigating their effects on biotic interactions is critical for detecting cascading impacts to inform more effective and comprehensive conservation strategies.
Additional Links: PMID-41769408
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41769408,
year = {2026},
author = {Seeburrun, G and Baider, C and Bissessur, P and Florens, FBV},
title = {A scoping literature review on the impacts of non-native species on the native terrestrial biodiversity of an oceanic island.},
journal = {PeerJ},
volume = {14},
number = {},
pages = {e20839},
pmid = {41769408},
issn = {2167-8359},
mesh = {*Biodiversity ; *Introduced Species ; Islands ; *Conservation of Natural Resources ; Animals ; },
abstract = {BACKGROUND: Many non-native species have been introduced to oceanic islands, with a subset becoming invasive, which pose the greatest threat to native terrestrial biodiversity. Yet, existing information on their impacts, particularly at the island scale, has rarely been synthesised. Addressing this gap is essential for revealing neglected aspects and for prioritising conservation management to optimise the use of scarce resources. Here, we use one volcanic oceanic island as a model to characterise the knowledge landscape about the impacts of non-native species on native biodiversity. Specifically, we (1) inventory the studied mechanisms through which non-native species affect native biodiversity; (2) evaluate the extent to which studies assess impacts at the level of biological organisation and/or biotic interactions; (3) assess the severity of impacts of non-native taxa and (4) highlight research gaps requiring most attention at the island scale.
METHOD: Mauritius was used for a scoping review based on four databases (Dimensions, Google Scholar, ScienceDirect and SpringerLink) to systematically search and identify relevant studies on the impacts of non-native species on native terrestrial biodiversity. We used the Environmental Impact Classification for Alien Taxa (EICAT) framework and its extension, EICAT+ to categorise the impact mechanisms and magnitude of impact. We searched for all records from the inception of each database until November 2023. We included 62 publications in the final analysis, selected from a total of 1,760 articles screened following the PRISMA guidelines for scoping reviews.
RESULTS: We recorded a total of 273 impact records between non-native and native species. Non-native species of plants and mammals were the most common, affecting a wide range of native taxonomic groups. Negative impacts predominated (65.2%), followed by positive impacts (34.1%), with few neutral impacts (0.7%). Competition and predation were the most studied negative impact mechanisms, typically impacting many native species while positive impacts of non-native species were mainly associated with the provision of trophic resources and typically impacted few species. The main impacts of non-native species on native species studied were at the level of biological organisation (N = 169), while only 22 of the impact records investigated their effects on biotic interactions.
CONCLUSION: Limited attention has been given to indirect mechanisms and the impacts of non-native species on biotic interactions. Future studies should prioritise these areas, as indirect mechanisms may reveal cumulative and often insidious pathways through which non-native species accelerate biodiversity loss, especially on islands. Investigating their effects on biotic interactions is critical for detecting cascading impacts to inform more effective and comprehensive conservation strategies.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Biodiversity
*Introduced Species
Islands
*Conservation of Natural Resources
Animals
RevDate: 2026-03-06
The Microbiome of an Invasive Antarctic insect, Eretmoptera Murphyi (Diptera: Chironomidae), and its Potential Role in Nutrient Cycling.
Microbial ecology, 89(1):.
UNLABELLED: Eretmoptera murphyi Schaeffer 1914 is a flightless chironomid midge endemic to South Georgia in the sub-Antarctic. In the 1960s it was accidentally introduced to Signy Island (in the more extreme maritime Antarctic), where it is now considered an invasive species. Detritivorous E. murphyi larvae can increase soil nitrogen levels by up to five times compared with similar uncolonized substrates, although the mechanisms involved remain unknown. This study conducted the first larval microbiome characterisation of E. murphyi, with the aim of identifying groups of microorganisms that may contribute to the elevated nutrient availability associated with this species. We also compare the E. murphyi microbiome with information available for other Antarctic invertebrates. Dominant archaea and bacteria included Crenarchaeota, Actinobacteriota, Chloroflexi, Proteobacteria and Planctomycetota, many of which have known roles in nutrient cycling. The microbiome of E. murphyi appears more diverse than that of other Antarctic invertebrates studied to date and includes phyla (Chloroflexi and Mycococcota) not previously reported from Signy Island soils or other Antarctic terrestrial invertebrate species. Further research is needed to establish which of these taxa represent true endosymbionts and to confirm their functional roles. The impact of non-native species microbiomes on nutrient cycling has important implications for polar terrestrial ecosystems, as significant changes in nutrient availability could impact native microarthropod and plant communities, as well as open new pathways for future non-native species establishment.
SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1007/s00248-026-02706-5.
Additional Links: PMID-41764142
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41764142,
year = {2026},
author = {Brayley, ODM and McCready, K and Liu, S and Convey, P and Chen, Y and Ullah, S and Teets, N and Hayward, SAL},
title = {The Microbiome of an Invasive Antarctic insect, Eretmoptera Murphyi (Diptera: Chironomidae), and its Potential Role in Nutrient Cycling.},
journal = {Microbial ecology},
volume = {89},
number = {1},
pages = {},
pmid = {41764142},
issn = {1432-184X},
support = {NE/S007350/1//NERC CENTA2/ ; NE/T009446/1//NSFGEO-NERC/ ; OPP-1850988//National Science Foundation/ ; 700545//USDA National Institute of Food and Agriculture Hatch Project/ ; RF-2024-396/2//Leverhulme Research Fellowship/ ; },
abstract = {UNLABELLED: Eretmoptera murphyi Schaeffer 1914 is a flightless chironomid midge endemic to South Georgia in the sub-Antarctic. In the 1960s it was accidentally introduced to Signy Island (in the more extreme maritime Antarctic), where it is now considered an invasive species. Detritivorous E. murphyi larvae can increase soil nitrogen levels by up to five times compared with similar uncolonized substrates, although the mechanisms involved remain unknown. This study conducted the first larval microbiome characterisation of E. murphyi, with the aim of identifying groups of microorganisms that may contribute to the elevated nutrient availability associated with this species. We also compare the E. murphyi microbiome with information available for other Antarctic invertebrates. Dominant archaea and bacteria included Crenarchaeota, Actinobacteriota, Chloroflexi, Proteobacteria and Planctomycetota, many of which have known roles in nutrient cycling. The microbiome of E. murphyi appears more diverse than that of other Antarctic invertebrates studied to date and includes phyla (Chloroflexi and Mycococcota) not previously reported from Signy Island soils or other Antarctic terrestrial invertebrate species. Further research is needed to establish which of these taxa represent true endosymbionts and to confirm their functional roles. The impact of non-native species microbiomes on nutrient cycling has important implications for polar terrestrial ecosystems, as significant changes in nutrient availability could impact native microarthropod and plant communities, as well as open new pathways for future non-native species establishment.
SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1007/s00248-026-02706-5.},
}
RevDate: 2025-05-25
CmpDate: 2025-02-27
The impact of climate change in pollen food allergy syndrome.
Current opinion in allergy and clinical immunology, 25(2):129-133.
PURPOSE OF REVIEW: To evaluate the effect of climate change on pollen allergenicity, lengthening of the pollen season, and the spread of invasive species such as ragweed. To assess evidence to determine whether these effects are impacting the prevalence of pollen food syndrome (PFS).
RECENT FINDINGS: There is good evidence to demonstrate that markers of climate change, including rising temperatures and to some extent greenhouse gases, are responsible for a rise in the allergenicity of pollen and an increase in the duration of the pollen season, especially for trees. These changes are likely to be linked to the increase in the prevalence of seasonal allergic rhinitis (SAR), especially in children. Sensitization to pollen, especially tree pollen, is also a risk factor for the development of PFS. Thought to mainly affect adults, recent evidence suggests that there is a rise in the prevalence of PFS in children, linked to an increase in SAR.
SUMMARY: Increasing SAR due to climate change could lead to a greater number of children and adults developing PFS. Although PFS is generally considered to be a mild condition, severe reactions can occur and there might be numerous plant food triggers, which can adversely affect dietary choice and nutritional intake.
Additional Links: PMID-39903212
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid39903212,
year = {2025},
author = {Skypala, IJ},
title = {The impact of climate change in pollen food allergy syndrome.},
journal = {Current opinion in allergy and clinical immunology},
volume = {25},
number = {2},
pages = {129-133},
doi = {10.1097/ACI.0000000000001064},
pmid = {39903212},
issn = {1473-6322},
mesh = {Humans ; *Climate Change ; *Food Hypersensitivity/epidemiology/immunology ; *Rhinitis, Allergic, Seasonal/epidemiology/immunology ; *Pollen/immunology/adverse effects ; *Allergens/immunology ; Prevalence ; Child ; Syndrome ; Adult ; Risk Factors ; Oral Allergy Syndrome ; },
abstract = {PURPOSE OF REVIEW: To evaluate the effect of climate change on pollen allergenicity, lengthening of the pollen season, and the spread of invasive species such as ragweed. To assess evidence to determine whether these effects are impacting the prevalence of pollen food syndrome (PFS).
RECENT FINDINGS: There is good evidence to demonstrate that markers of climate change, including rising temperatures and to some extent greenhouse gases, are responsible for a rise in the allergenicity of pollen and an increase in the duration of the pollen season, especially for trees. These changes are likely to be linked to the increase in the prevalence of seasonal allergic rhinitis (SAR), especially in children. Sensitization to pollen, especially tree pollen, is also a risk factor for the development of PFS. Thought to mainly affect adults, recent evidence suggests that there is a rise in the prevalence of PFS in children, linked to an increase in SAR.
SUMMARY: Increasing SAR due to climate change could lead to a greater number of children and adults developing PFS. Although PFS is generally considered to be a mild condition, severe reactions can occur and there might be numerous plant food triggers, which can adversely affect dietary choice and nutritional intake.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Humans
*Climate Change
*Food Hypersensitivity/epidemiology/immunology
*Rhinitis, Allergic, Seasonal/epidemiology/immunology
*Pollen/immunology/adverse effects
*Allergens/immunology
Prevalence
Child
Syndrome
Adult
Risk Factors
Oral Allergy Syndrome
RevDate: 2026-03-07
CmpDate: 2026-03-07
Invasive Argemone mexicana's suppressive effects on germination and early growth of Triticum aestivum and Hordeum vulgare in South-western Saudi Arabia.
PloS one, 21(3):e0344281.
The invasion of exotic plant species has emerged as a global problem that impacts the ecosystems, economy, and human health, and is the reason for biodiversity loss. Argemone mexicana L. is one of the plants that was recorded as an invasive plant species in south-western Saudi Arabia. Allelochemical properties have been stated but not empirically evaluated on economically important staple crops. In the present study, the phenotype of the A. mexicana L. plant was described using major and minor phenotypic morphology, and morphological seed. Additionally, laboratory experiments were conducted to evaluate the allelopathic effects of water extract of A. mexicana L. on radicle and plumule length of Triticum aestivum and Hordeum vulgare. Results showed that the allelopathic potential of leaf and seed extracts of A. mexicana decreased the seed germination (until 66.66%), plumule length (93.94%-94.94%), and radicle length (96.68%- 96.96%) respectively for T. aestivum and H. vulgare with a rise in extract concentration. Moreover, it was observed that the A. mexicana seed extract is more allelopathically effective than leaf extract. Hence, it could be concluded that the seed and leaf aqueous extracts contain water-soluble allelochemicals, which could inhibit seed germination of T. aestivum and H. vulgare.
Additional Links: PMID-41790771
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41790771,
year = {2026},
author = {Alshaqhaa, MA and Souid, I and Alshehri, MD and Alyahya, N and Msaada, K and Guedri, MM},
title = {Invasive Argemone mexicana's suppressive effects on germination and early growth of Triticum aestivum and Hordeum vulgare in South-western Saudi Arabia.},
journal = {PloS one},
volume = {21},
number = {3},
pages = {e0344281},
pmid = {41790771},
issn = {1932-6203},
mesh = {*Triticum/growth & development/drug effects ; *Germination/drug effects ; *Hordeum/growth & development/drug effects ; Saudi Arabia ; *Plant Extracts/pharmacology ; Seeds/growth & development/chemistry ; Plant Leaves/chemistry ; *Argemone/chemistry ; *Introduced Species ; },
abstract = {The invasion of exotic plant species has emerged as a global problem that impacts the ecosystems, economy, and human health, and is the reason for biodiversity loss. Argemone mexicana L. is one of the plants that was recorded as an invasive plant species in south-western Saudi Arabia. Allelochemical properties have been stated but not empirically evaluated on economically important staple crops. In the present study, the phenotype of the A. mexicana L. plant was described using major and minor phenotypic morphology, and morphological seed. Additionally, laboratory experiments were conducted to evaluate the allelopathic effects of water extract of A. mexicana L. on radicle and plumule length of Triticum aestivum and Hordeum vulgare. Results showed that the allelopathic potential of leaf and seed extracts of A. mexicana decreased the seed germination (until 66.66%), plumule length (93.94%-94.94%), and radicle length (96.68%- 96.96%) respectively for T. aestivum and H. vulgare with a rise in extract concentration. Moreover, it was observed that the A. mexicana seed extract is more allelopathically effective than leaf extract. Hence, it could be concluded that the seed and leaf aqueous extracts contain water-soluble allelochemicals, which could inhibit seed germination of T. aestivum and H. vulgare.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Triticum/growth & development/drug effects
*Germination/drug effects
*Hordeum/growth & development/drug effects
Saudi Arabia
*Plant Extracts/pharmacology
Seeds/growth & development/chemistry
Plant Leaves/chemistry
*Argemone/chemistry
*Introduced Species
RevDate: 2026-03-07
CmpDate: 2026-03-07
Evolutionary Dynamics at the Leading Edge of Biological Invasions.
Bulletin of mathematical biology, 88(4):.
Empirical evidence shows that evolution may take place during species' range expansion. Indeed, dispersal ability tends to be selected for at the leading edge of invasions, ultimately increasing a species' spreading speed. However, for organisms across many different taxa, higher dispersal comes at the cost of fitness, producing evolutionary trade-offs at the leading edge. Using reaction-diffusion equations and adaptive dynamics, we provide new insights on how such evolutionary processes take place. We show how evolution may drive phenotypes at the leading edge to maximize the asymptotic spreading speed, and we give conditions under which phenotypic plasticity in dispersal is selected for under different dispersal-reproduction trade-off scenarios. We provide some possible future research directions and other systems where the framework can be applied.
Additional Links: PMID-41779299
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41779299,
year = {2026},
author = {Poloni, S and Lutscher, F and Lewis, MA},
title = {Evolutionary Dynamics at the Leading Edge of Biological Invasions.},
journal = {Bulletin of mathematical biology},
volume = {88},
number = {4},
pages = {},
pmid = {41779299},
issn = {1522-9602},
support = {RGPIN-2024-05210//Natural Sciences and Engineering Research Council of Canada/ ; RGPIN-2023-03872//Natural Sciences and Engineering Research Council of Canada/ ; },
mesh = {*Biological Evolution ; Mathematical Concepts ; *Models, Biological ; *Introduced Species/statistics & numerical data ; Population Dynamics ; Animals ; Phenotype ; Ecosystem ; Genetic Fitness ; },
abstract = {Empirical evidence shows that evolution may take place during species' range expansion. Indeed, dispersal ability tends to be selected for at the leading edge of invasions, ultimately increasing a species' spreading speed. However, for organisms across many different taxa, higher dispersal comes at the cost of fitness, producing evolutionary trade-offs at the leading edge. Using reaction-diffusion equations and adaptive dynamics, we provide new insights on how such evolutionary processes take place. We show how evolution may drive phenotypes at the leading edge to maximize the asymptotic spreading speed, and we give conditions under which phenotypic plasticity in dispersal is selected for under different dispersal-reproduction trade-off scenarios. We provide some possible future research directions and other systems where the framework can be applied.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Biological Evolution
Mathematical Concepts
*Models, Biological
*Introduced Species/statistics & numerical data
Population Dynamics
Animals
Phenotype
Ecosystem
Genetic Fitness
RevDate: 2026-03-07
CmpDate: 2026-03-07
Investigating key drivers influencing AI-based detection and identification of plants.
PloS one, 21(3):e0342712.
In recent years, AI-driven platforms have transformed citizen science by collecting and generating valuable records of living organisms for monitoring biological data. Many applications utilize visual similarity and geospatial information to identify species based on photographs. This study investigates how location impacts plant identifications made by iNaturalist, particularly in detecting invasive alien plants (IAP) that are not established in an area. We also compare the accuracy of iNaturalist and PlantNet while exploring potential biases. To assess iNaturalist's taxonomic accuracy under varying location parameters, specimens of plants that are native and naturalized in Ontario, termed "established plants" for the purpose of this study, were collected and photographed (n = 61) and photographs of plants from Canada's regulated pest list, which are either not present or have a very limited distribution in Canada, termed "outsider plants" for the purpose of this study were exported from iNaturalist and GBIF (n = 402). We used photographs of the established plants to compare taxonomic accuracy between applications, considering factors such as plant families, distribution status, and visible parts. A scoring system was established, and a cumulative linked mixed model was applied to analyze taxonomic accuracy. Our findings reveal that restricting location significantly hinders iNaturalist's ability to identify IAP, highlighting the potential for missed detections. While sample size limitations prevented a robust comparison between applications, we also found significantly lower identification accuracy for species in the Poaceae family and for photographs featuring only leaves. Ultimately, recognizing the influence of location is essential for effectively monitoring IAP and leveraging iNaturalist as a tool for early detection.
Additional Links: PMID-41770734
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41770734,
year = {2026},
author = {Charron, A and Julien, A and Stinziano, JR and Gagnon, MC},
title = {Investigating key drivers influencing AI-based detection and identification of plants.},
journal = {PloS one},
volume = {21},
number = {3},
pages = {e0342712},
pmid = {41770734},
issn = {1932-6203},
mesh = {*Plants/classification ; *Introduced Species ; Ontario ; *Artificial Intelligence ; Photography ; },
abstract = {In recent years, AI-driven platforms have transformed citizen science by collecting and generating valuable records of living organisms for monitoring biological data. Many applications utilize visual similarity and geospatial information to identify species based on photographs. This study investigates how location impacts plant identifications made by iNaturalist, particularly in detecting invasive alien plants (IAP) that are not established in an area. We also compare the accuracy of iNaturalist and PlantNet while exploring potential biases. To assess iNaturalist's taxonomic accuracy under varying location parameters, specimens of plants that are native and naturalized in Ontario, termed "established plants" for the purpose of this study, were collected and photographed (n = 61) and photographs of plants from Canada's regulated pest list, which are either not present or have a very limited distribution in Canada, termed "outsider plants" for the purpose of this study were exported from iNaturalist and GBIF (n = 402). We used photographs of the established plants to compare taxonomic accuracy between applications, considering factors such as plant families, distribution status, and visible parts. A scoring system was established, and a cumulative linked mixed model was applied to analyze taxonomic accuracy. Our findings reveal that restricting location significantly hinders iNaturalist's ability to identify IAP, highlighting the potential for missed detections. While sample size limitations prevented a robust comparison between applications, we also found significantly lower identification accuracy for species in the Poaceae family and for photographs featuring only leaves. Ultimately, recognizing the influence of location is essential for effectively monitoring IAP and leveraging iNaturalist as a tool for early detection.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Plants/classification
*Introduced Species
Ontario
*Artificial Intelligence
Photography
RevDate: 2026-03-06
Competitive interactions during community assembly: how native species identity, diversity, and functional traits affect invasion.
Oecologia, 208(3):.
Competitive interactions during community assembly are critical for suppressing invasive species and restoring native biodiversity. However, the roles of plant community attributes in determining competitive suppression remain unclear. We examined the competitive suppression of the invasive perennial herb Solidago altissima L. through a two-year greenhouse experiment. To assess species identity effects, we established pairwise competitions between S. altissima and 19 native species. Diversity effects were evaluated by comparing invasion success in eight four-species native mixtures versus monocultures using relative competition indices (RCI) based on height, cover, density, and biomass. Species identity and functional groups were critical determinants of competitive outcomes. 14 native species significantly suppressed S. altissima growth, with annual herbs (RCI = 0.608-0.771) and perennial herbs (RCI = 0.471-0.666) providing the strongest suppression, while woody perennials were the least effective (RCI = 0.197-0.250). Species diversity showed marginally positive but non-significant effects. Competitive suppression of S. altissima was marginally stronger in mixtures than in monocultures by the second year (mixture RCI = 0.764, monoculture RCI = 0.531, P = 0.084). Functional traits showed inconsistent relationships with competitive outcomes, and trait similarity did not predict invasion suppression. Our results indicate that competitive suppression is primarily driven by species and functional group identities rather than by diversity or trait similarities. Restoration efforts should prioritize fast-growing, canopy-covering non-woody native annuals and perennials-particularly forbs with high specific leaf area, large seed mass, and early canopy dominance-to maximize competitive suppression during community assembly.
Additional Links: PMID-41790308
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41790308,
year = {2026},
author = {Jeong, D and Singh, K and Byun, C},
title = {Competitive interactions during community assembly: how native species identity, diversity, and functional traits affect invasion.},
journal = {Oecologia},
volume = {208},
number = {3},
pages = {},
pmid = {41790308},
issn = {1432-1939},
support = {2022R1A2C1003504//National Research Foundation of Korea/ ; B0080529001944//Ministry of Education/ ; },
abstract = {Competitive interactions during community assembly are critical for suppressing invasive species and restoring native biodiversity. However, the roles of plant community attributes in determining competitive suppression remain unclear. We examined the competitive suppression of the invasive perennial herb Solidago altissima L. through a two-year greenhouse experiment. To assess species identity effects, we established pairwise competitions between S. altissima and 19 native species. Diversity effects were evaluated by comparing invasion success in eight four-species native mixtures versus monocultures using relative competition indices (RCI) based on height, cover, density, and biomass. Species identity and functional groups were critical determinants of competitive outcomes. 14 native species significantly suppressed S. altissima growth, with annual herbs (RCI = 0.608-0.771) and perennial herbs (RCI = 0.471-0.666) providing the strongest suppression, while woody perennials were the least effective (RCI = 0.197-0.250). Species diversity showed marginally positive but non-significant effects. Competitive suppression of S. altissima was marginally stronger in mixtures than in monocultures by the second year (mixture RCI = 0.764, monoculture RCI = 0.531, P = 0.084). Functional traits showed inconsistent relationships with competitive outcomes, and trait similarity did not predict invasion suppression. Our results indicate that competitive suppression is primarily driven by species and functional group identities rather than by diversity or trait similarities. Restoration efforts should prioritize fast-growing, canopy-covering non-woody native annuals and perennials-particularly forbs with high specific leaf area, large seed mass, and early canopy dominance-to maximize competitive suppression during community assembly.},
}
RevDate: 2026-03-06
CmpDate: 2026-03-06
Phenotypic selection in weedy radish and its bidirectional crop-weed hybrids across two contrasting environments.
AoB PLANTS, 18(2):plag010.
Hybridization is a key mechanism in the adaptive evolution of weeds and invasive species. The evolutionary success of hybrids may be shaped by selection on functional traits, interacting with maternal genotype and ecological context. We performed experimental hybridization and common garden field experiments to assess phenotypic variation on functional traits, and the strength and direction of linear and quadratic selection acting on them, in bidirectional crop-weed hybrids and their parents of Raphanus sativus, across two contrasting environments: agrestal (agricultural) and ruderal (human-disturbed uncultivated area), over two years. Bidirectional hybrids exhibited overall greater values for size-related traits than their parents, with similar flowering time and no significant effects of cross direction. Selection acted on multiple functional traits through both linear and quadratic components, with broadly similar patterns across environments and cross types, although selection tended to be slightly stronger in hybrids than in weeds. Intraspecific crop-weed hybridization, regardless of cross direction, can increase weediness in weedy radish by enhancing plant size, thereby increasing competitive ability and potential interference with crops. Our findings highlight how hybridization and selection shape plant evolution, influencing the potential introgression of crop alleles into wild or weedy gene pools. Understanding the hybridization process and the mechanisms that control it is crucial for managing the evolutionary outcomes of crop-weed hybridization.
Additional Links: PMID-41788914
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41788914,
year = {2026},
author = {Vercellino, RB and Hernández, F and Tillería, S and Simian, D and Fanna, I and Presotto, A},
title = {Phenotypic selection in weedy radish and its bidirectional crop-weed hybrids across two contrasting environments.},
journal = {AoB PLANTS},
volume = {18},
number = {2},
pages = {plag010},
pmid = {41788914},
issn = {2041-2851},
abstract = {Hybridization is a key mechanism in the adaptive evolution of weeds and invasive species. The evolutionary success of hybrids may be shaped by selection on functional traits, interacting with maternal genotype and ecological context. We performed experimental hybridization and common garden field experiments to assess phenotypic variation on functional traits, and the strength and direction of linear and quadratic selection acting on them, in bidirectional crop-weed hybrids and their parents of Raphanus sativus, across two contrasting environments: agrestal (agricultural) and ruderal (human-disturbed uncultivated area), over two years. Bidirectional hybrids exhibited overall greater values for size-related traits than their parents, with similar flowering time and no significant effects of cross direction. Selection acted on multiple functional traits through both linear and quadratic components, with broadly similar patterns across environments and cross types, although selection tended to be slightly stronger in hybrids than in weeds. Intraspecific crop-weed hybridization, regardless of cross direction, can increase weediness in weedy radish by enhancing plant size, thereby increasing competitive ability and potential interference with crops. Our findings highlight how hybridization and selection shape plant evolution, influencing the potential introgression of crop alleles into wild or weedy gene pools. Understanding the hybridization process and the mechanisms that control it is crucial for managing the evolutionary outcomes of crop-weed hybridization.},
}
RevDate: 2026-03-05
CmpDate: 2026-03-05
Marsh Interspersion and Muskrat (Ondatra zibethicus) Habitat Use.
Ecology and evolution, 16(3):e73155.
Muskrat (Ondatra zibethicus) populations have been declining in North America for decades. The precise cause of these widespread declines has not yet been identified. Over a similar timeframe, wetlands across large regions of North America have been experiencing an invasion of hybrid cattail Typha x glauca. This invasion is associated with many negative consequences for wetlands, including a reduction in biodiversity, open water habitat, and interspersion of water and vegetation. Muskrats are strongly tied to wetlands, especially where there is a high degree of interspersion of water and emergent vegetation. Therefore, a widespread reduction in interspersion caused by T. x glauca invasions may be contributing to widespread muskrat population declines. We sought to better understand the impact of marsh interspersion on fine-scale muskrat habitat use in light of widespread invasions of T. x glauca. We measured intensity of habitat use by muskrats in a large, Typha-dominated marsh in south-central Ontario using camera traps, stratifying camera placement along a gradient of interspersion. We found no correlation between interspersion and intensity of use. The ubiquity of T. x glauca and low overall interspersion at our study site may have prevented a robust test of our hypothesis. Further research is needed to determine precisely how interspersion affects muskrat habitat use at a fine scale, and how potential changes in habitat quality and use may be contributing to widespread muskrat population declines.
Additional Links: PMID-41783353
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41783353,
year = {2026},
author = {Melvin, GP and Bowman, J},
title = {Marsh Interspersion and Muskrat (Ondatra zibethicus) Habitat Use.},
journal = {Ecology and evolution},
volume = {16},
number = {3},
pages = {e73155},
pmid = {41783353},
issn = {2045-7758},
abstract = {Muskrat (Ondatra zibethicus) populations have been declining in North America for decades. The precise cause of these widespread declines has not yet been identified. Over a similar timeframe, wetlands across large regions of North America have been experiencing an invasion of hybrid cattail Typha x glauca. This invasion is associated with many negative consequences for wetlands, including a reduction in biodiversity, open water habitat, and interspersion of water and vegetation. Muskrats are strongly tied to wetlands, especially where there is a high degree of interspersion of water and emergent vegetation. Therefore, a widespread reduction in interspersion caused by T. x glauca invasions may be contributing to widespread muskrat population declines. We sought to better understand the impact of marsh interspersion on fine-scale muskrat habitat use in light of widespread invasions of T. x glauca. We measured intensity of habitat use by muskrats in a large, Typha-dominated marsh in south-central Ontario using camera traps, stratifying camera placement along a gradient of interspersion. We found no correlation between interspersion and intensity of use. The ubiquity of T. x glauca and low overall interspersion at our study site may have prevented a robust test of our hypothesis. Further research is needed to determine precisely how interspersion affects muskrat habitat use at a fine scale, and how potential changes in habitat quality and use may be contributing to widespread muskrat population declines.},
}
RevDate: 2026-03-06
CmpDate: 2026-03-06
Nucleolar dominance arises in Spartina homoploid hybrids and persists after allopolyploidization.
The Plant journal : for cell and molecular biology, 125(5):e70770.
Allopolyploid Spartina anglica C.E. Hubbard (2n = 120-124) has become recognized as a model system of recent allopolyploid speciation. It arose by interspecific hybridization between S. alterniflora (2n = 62) introduced from North America and the native European S. maritima (2n = 60) about 150 years ago. In addition, sterile first-generation homoploid hybrids S. × townsendii and S. × neyrautii (both 2n = 62) are still extant. In this study, we carried out a population-level study of epigenetic silencing of 35S rDNA loci, also known as nucleolar dominance. Using molecular, genomic, and cytogenetic methods, we analyzed 75 individuals of S. anglica (collected from 11 French populations and 5 UK populations), 34 individuals of S. × townsendii (3 populations, all from the UK), and 2 individuals of S. × neyrautii from the south of France. We observed strong transcriptional dominance of S. alterniflora-inherited rDNA in all hybrid and allopolyploid individuals. The dominant rDNA units were nearly devoid of methylation at CWG sites, in contrast to those of the silenced S. maritima-inherited rDNA (M-loci), which exhibited hypermethylation. At the DNA level, few (2%) S. anglica individuals have completely lost M-loci, indicating that rDNA diploidization proceeds extremely fast in Spartina, and such a process may be influenced by preceding epigenetic processes. We conclude that nucleolar dominance is already present in extant homoploid hybrid lineages and is largely maintained in S. anglica, with occasional partial relaxation.
Additional Links: PMID-41782262
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41782262,
year = {2026},
author = {Kuderová, A and Húska, D and de Carvalho, JF and Matyášek, R and Leitch, IJ and Salmon, A and Leitch, AR and Ainouche, M and Kovařík, A},
title = {Nucleolar dominance arises in Spartina homoploid hybrids and persists after allopolyploidization.},
journal = {The Plant journal : for cell and molecular biology},
volume = {125},
number = {5},
pages = {e70770},
pmid = {41782262},
issn = {1365-313X},
support = {25-16796S//Grantová Agentura České Republiky/ ; //Centre National de la Recherche Scientifique/ ; //Natural Environment Research Council/ ; },
mesh = {*Polyploidy ; Hybridization, Genetic ; DNA, Ribosomal/genetics ; *Poaceae/genetics ; *Cell Nucleolus/genetics ; France ; DNA Methylation ; DNA, Plant/genetics ; },
abstract = {Allopolyploid Spartina anglica C.E. Hubbard (2n = 120-124) has become recognized as a model system of recent allopolyploid speciation. It arose by interspecific hybridization between S. alterniflora (2n = 62) introduced from North America and the native European S. maritima (2n = 60) about 150 years ago. In addition, sterile first-generation homoploid hybrids S. × townsendii and S. × neyrautii (both 2n = 62) are still extant. In this study, we carried out a population-level study of epigenetic silencing of 35S rDNA loci, also known as nucleolar dominance. Using molecular, genomic, and cytogenetic methods, we analyzed 75 individuals of S. anglica (collected from 11 French populations and 5 UK populations), 34 individuals of S. × townsendii (3 populations, all from the UK), and 2 individuals of S. × neyrautii from the south of France. We observed strong transcriptional dominance of S. alterniflora-inherited rDNA in all hybrid and allopolyploid individuals. The dominant rDNA units were nearly devoid of methylation at CWG sites, in contrast to those of the silenced S. maritima-inherited rDNA (M-loci), which exhibited hypermethylation. At the DNA level, few (2%) S. anglica individuals have completely lost M-loci, indicating that rDNA diploidization proceeds extremely fast in Spartina, and such a process may be influenced by preceding epigenetic processes. We conclude that nucleolar dominance is already present in extant homoploid hybrid lineages and is largely maintained in S. anglica, with occasional partial relaxation.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Polyploidy
Hybridization, Genetic
DNA, Ribosomal/genetics
*Poaceae/genetics
*Cell Nucleolus/genetics
France
DNA Methylation
DNA, Plant/genetics
RevDate: 2026-03-06
CmpDate: 2026-03-06
[Identification and evaluation of cold source risk organisms in close areas of a coastal nuclear power plant].
Ying yong sheng tai xue bao = The journal of applied ecology, 37(2):551-562.
Species invasion in marine has increased the frequency of security incidents at coastal nuclear power plants, posing serious threats to the cooling water intake. To systematically identify the risk organisms in nuclear power cooling water sources and clarify their distribution pattern, we established a risk identification and assessment framework for marine organisms in cooling water intake areas. Based on field investigation conducted in the summer of 2024 in the adjacent waters of a nuclear power plant in northern China, we categorized marine organisms into five types: phytoplankton, zooplankton, swimming animals, benthic animals, and selected intertidal organisms. Trophic level, habitat layer, body size, body length, and density were used as evaluation criteria. These indices were combined with type-specific traits (e.g., migratory behavior and reproduction mode) to develop a scoring system, with each indicator being assigned a maximum score of 10 points. Scores were determined based on the potential risk of each biological trait to clogging the water intake, and a spatial weight based on the distance from sampling points to the intake was incorporated to calculate the total risk score for each species. We classified risk levels into low, medium, and high according to thresholds set at 30% and 80% of the total possible score. Results showed that a total of 40 phytoplankton, 28 zooplankton, 27 swimming animals, 62 benthic animals, and 43 intertidal species were recorded. Through multi-indicator integration and spatial weighting analysis-balancing field data authenticity and theoretical traits of species, Loligo sp., Charybdis japonica, and Konosirus punctatus were identified as high-risk species. Moreover, there was a higher density of high-risk organisms in the northern area near the water intake. By integrating functional traits and measured data into a comprehensive evaluation framework, this study could provide a scientific basis for risk organism identification, early warning, and the development of prevention and control strategies for cooling water systems near nuclear power plants.
Additional Links: PMID-41777209
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41777209,
year = {2026},
author = {Hu, XY and Cui, M and Jin, Y and Liu, GZ and Song, CC and Zhang, YL},
title = {[Identification and evaluation of cold source risk organisms in close areas of a coastal nuclear power plant].},
journal = {Ying yong sheng tai xue bao = The journal of applied ecology},
volume = {37},
number = {2},
pages = {551-562},
doi = {10.13287/j.1001-9332.202602.031},
pmid = {41777209},
issn = {1001-9332},
mesh = {Animals ; *Nuclear Power Plants ; China ; *Ecosystem ; Phytoplankton/growth & development ; *Aquatic Organisms/growth & development/classification ; *Environmental Monitoring/methods ; Risk Assessment ; Zooplankton/growth & development ; *Introduced Species ; Cold Temperature ; Oceans and Seas ; },
abstract = {Species invasion in marine has increased the frequency of security incidents at coastal nuclear power plants, posing serious threats to the cooling water intake. To systematically identify the risk organisms in nuclear power cooling water sources and clarify their distribution pattern, we established a risk identification and assessment framework for marine organisms in cooling water intake areas. Based on field investigation conducted in the summer of 2024 in the adjacent waters of a nuclear power plant in northern China, we categorized marine organisms into five types: phytoplankton, zooplankton, swimming animals, benthic animals, and selected intertidal organisms. Trophic level, habitat layer, body size, body length, and density were used as evaluation criteria. These indices were combined with type-specific traits (e.g., migratory behavior and reproduction mode) to develop a scoring system, with each indicator being assigned a maximum score of 10 points. Scores were determined based on the potential risk of each biological trait to clogging the water intake, and a spatial weight based on the distance from sampling points to the intake was incorporated to calculate the total risk score for each species. We classified risk levels into low, medium, and high according to thresholds set at 30% and 80% of the total possible score. Results showed that a total of 40 phytoplankton, 28 zooplankton, 27 swimming animals, 62 benthic animals, and 43 intertidal species were recorded. Through multi-indicator integration and spatial weighting analysis-balancing field data authenticity and theoretical traits of species, Loligo sp., Charybdis japonica, and Konosirus punctatus were identified as high-risk species. Moreover, there was a higher density of high-risk organisms in the northern area near the water intake. By integrating functional traits and measured data into a comprehensive evaluation framework, this study could provide a scientific basis for risk organism identification, early warning, and the development of prevention and control strategies for cooling water systems near nuclear power plants.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Nuclear Power Plants
China
*Ecosystem
Phytoplankton/growth & development
*Aquatic Organisms/growth & development/classification
*Environmental Monitoring/methods
Risk Assessment
Zooplankton/growth & development
*Introduced Species
Cold Temperature
Oceans and Seas
RevDate: 2026-03-06
CmpDate: 2026-03-06
Surviving the Squeeze: Genomic Analysis of a Successful Invasion by European Common Wall Lizards (Podarcis muralis) in North America (Ohio, USA).
Molecular ecology, 35(5):e70288.
Invasive species that undergo a founder event may experience a decline in genetic diversity yet still establish successful populations. A possible example is a population of the common wall lizard (Podarcis muralis) in Cincinnati, Ohio, USA, which was founded following an introduction in the 1950s of a small number of individuals from Europe. We used whole genome sequences of individuals from source and introduced populations to assess the origin, demographic history, population structure, and possible signatures of adaptation in this successful lizard introduction. We first confirmed that the introduced lizards in Ohio are Podarcis muralis using phylogenetic analysis. Patterns of genetic diversity indicate introduced lizards in Cincinnati went through a short-term bottleneck with increased inbreeding but then rapidly increased in population size, thus minimising losses in genetic diversity. Comparisons of genomic variation between source and introduced populations demonstrate that populations in Cincinnati represent a subset of source genetic variation and show minimal losses of overall genetic diversity. Comparisons of mutation load between source and introduced populations reveal only small increases in load in introduced populations. Finally, tests for selection on the basis of outlier analyses detect targets for potential positive selection in multiple regions of the genome of introduced individuals, suggesting possible adaptation to a novel environment. Overall, we suggest that rapid population growth and possible adaptation have allowed the founding population of introduced lizards to evade the potential negative genetic impacts of small population size and successfully colonise a novel environment.
Additional Links: PMID-41776974
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41776974,
year = {2026},
author = {Bode, ER and Mason, AJ and Bolton, PE and Petren, K and Gangloff, EJ and Gibbs, HL},
title = {Surviving the Squeeze: Genomic Analysis of a Successful Invasion by European Common Wall Lizards (Podarcis muralis) in North America (Ohio, USA).},
journal = {Molecular ecology},
volume = {35},
number = {5},
pages = {e70288},
pmid = {41776974},
issn = {1365-294X},
support = {2217826//National Science Foundation BRC-BIO Award No/ ; },
mesh = {Animals ; *Lizards/genetics ; *Introduced Species ; *Genetic Variation ; Phylogeny ; *Genetics, Population ; Ohio ; Genomics ; Population Density ; Europe ; },
abstract = {Invasive species that undergo a founder event may experience a decline in genetic diversity yet still establish successful populations. A possible example is a population of the common wall lizard (Podarcis muralis) in Cincinnati, Ohio, USA, which was founded following an introduction in the 1950s of a small number of individuals from Europe. We used whole genome sequences of individuals from source and introduced populations to assess the origin, demographic history, population structure, and possible signatures of adaptation in this successful lizard introduction. We first confirmed that the introduced lizards in Ohio are Podarcis muralis using phylogenetic analysis. Patterns of genetic diversity indicate introduced lizards in Cincinnati went through a short-term bottleneck with increased inbreeding but then rapidly increased in population size, thus minimising losses in genetic diversity. Comparisons of genomic variation between source and introduced populations demonstrate that populations in Cincinnati represent a subset of source genetic variation and show minimal losses of overall genetic diversity. Comparisons of mutation load between source and introduced populations reveal only small increases in load in introduced populations. Finally, tests for selection on the basis of outlier analyses detect targets for potential positive selection in multiple regions of the genome of introduced individuals, suggesting possible adaptation to a novel environment. Overall, we suggest that rapid population growth and possible adaptation have allowed the founding population of introduced lizards to evade the potential negative genetic impacts of small population size and successfully colonise a novel environment.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Lizards/genetics
*Introduced Species
*Genetic Variation
Phylogeny
*Genetics, Population
Ohio
Genomics
Population Density
Europe
RevDate: 2026-03-04
Environmental DNA metabarcoding facilitates integrative conservation assessments and species rediscoveries in tropical biodiversity hotspots.
Scientific reports, 16(1):.
UNLABELLED: Environmental DNA (eDNA) metabarcoding is an emerging and versatile tool in biodiversity research. With recent advances in field sampling techniques, this approach becomes increasingly suited for application in tropical ecosystems where biodiversity monitoring gaps remain significant and species detection is particularly challenging. Using amphibians as a model, we harness eDNA metabarcoding in 52 localities in the Tropical Andean biodiversity hotspot to rapidly trace elusive, threatened, or presumed extinct species as a baseline for conservation action. Metabarcoding ‘bycatch’ of non-target species further revealed specific environmental threats through the detection of invasive species and pathogens, thus facilitating integrative conservation assessments despite the incompleteness of reference data and the vast species richness hampering biodiversity assessments in complex tropical communities. Consequently, we call for more intense employment of eDNA metabarcoding in conservation to rapidly bridge critical knowledge gaps on elusive species or declining populations in tropical biodiversity hotspots.
SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1038/s41598-026-41937-x.
Additional Links: PMID-41775849
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41775849,
year = {2026},
author = {Plewnia, A and Hildwein, T and Quezada Riera, AB and Terán-Valdez, A and Crawford, AJ and Heine, C and Franco-Mena, D and Székely, D and Armijos-Ojeda, D and Siavichay, FR and Arpi, JD and Salazar, J and Erens, J and Páez-Vacas, MI and Székely, P and Böning, P and Stassen, R and Carvajal-Endara, S and Lötters, S and Guayasamin, JM},
title = {Environmental DNA metabarcoding facilitates integrative conservation assessments and species rediscoveries in tropical biodiversity hotspots.},
journal = {Scientific reports},
volume = {16},
number = {1},
pages = {},
pmid = {41775849},
issn = {2045-2322},
abstract = {UNLABELLED: Environmental DNA (eDNA) metabarcoding is an emerging and versatile tool in biodiversity research. With recent advances in field sampling techniques, this approach becomes increasingly suited for application in tropical ecosystems where biodiversity monitoring gaps remain significant and species detection is particularly challenging. Using amphibians as a model, we harness eDNA metabarcoding in 52 localities in the Tropical Andean biodiversity hotspot to rapidly trace elusive, threatened, or presumed extinct species as a baseline for conservation action. Metabarcoding ‘bycatch’ of non-target species further revealed specific environmental threats through the detection of invasive species and pathogens, thus facilitating integrative conservation assessments despite the incompleteness of reference data and the vast species richness hampering biodiversity assessments in complex tropical communities. Consequently, we call for more intense employment of eDNA metabarcoding in conservation to rapidly bridge critical knowledge gaps on elusive species or declining populations in tropical biodiversity hotspots.
SUPPLEMENTARY INFORMATION: The online version contains supplementary material available at 10.1038/s41598-026-41937-x.},
}
RevDate: 2026-03-03
Metagenomic and gene expression patterns in declining commercial honey bee colonies.
Scientific reports pii:10.1038/s41598-026-42605-w [Epub ahead of print].
Additional Links: PMID-41775798
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41775798,
year = {2026},
author = {Nearman, A and Lamas, ZS and Niño, EL and Fine, J and Mayack, C and Seshadri, A and Boncristiani, D and Huang, WF and Evans, JD and Chen, YP},
title = {Metagenomic and gene expression patterns in declining commercial honey bee colonies.},
journal = {Scientific reports},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41598-026-42605-w},
pmid = {41775798},
issn = {2045-2322},
support = {FSA25IRA0012292//Farm Service Agency/ ; 8130-0960//Animal and Plant Health Inspection Service/ ; },
}
RevDate: 2026-03-03
Integrative omics approaches reveal mechanisms of combined heat stress and extreme hypoxia tolerance in a Cerambycid beetle larva.
The Journal of experimental biology pii:370919 [Epub ahead of print].
Atmospheric oxygen, which is essential for energy metabolism, can directly influence an animal's heat tolerance by affecting oxygen transport processes, especially in those living in oxygen-poor environments such as plant tissues, underground or aquatic environments. Yet, oxygen availability and heat tolerance are rarely studied together, limiting our ability to predict their combined effects on insect performance. This study examines the larval tolerance of a large xylophagous cerambycid beetle Cacosceles newmannii to combined hypoxic and thermal stress using performance assays (duration of righting response) coupled with metabolomic and transcriptomic analyses. Metabolomic profiling showed that most metabolites were downregulated in the body but upregulated in the haemolymph as stress increased. Transcriptomic profiles clustered primarily by temperature (25 °C vs 35 °C), independent of oxygen level. Cacosceles newmannii appeared capable of modulating its performance to reduce the energy costs and physiological damage induced by hypoxia. This suggested a high baseline hypoxia tolerance rather than a rapid plastic (induced) physiological hypoxia response, probably due to the species' endophytic lifestyle. Conversely, thermal stress led to a predictable increase in metabolic activity but did not markedly affect performance, triggering adjustments to maintain cellular functions while limiting the impact of stresses expected under conditions of high temperature, such as desiccation. In short, our study highlights the distinct metabolic pathways mobilised to cope with hypoxic versus thermal stress, emphasizing the importance of integrated approaches in understanding insect responses to environmental challenges. These findings have significant implications for understanding the species' ecology, with applications for pest management and sustainable agriculture in the context of climate change.
Additional Links: PMID-41772970
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41772970,
year = {2026},
author = {Javal, M and Lehmann, P and Bierman, A and Koštál, V and Moos, M and Smit, C and Vogel, H and Conlong, DE and Terblanche, JS},
title = {Integrative omics approaches reveal mechanisms of combined heat stress and extreme hypoxia tolerance in a Cerambycid beetle larva.},
journal = {The Journal of experimental biology},
volume = {},
number = {},
pages = {},
doi = {10.1242/jeb.251552},
pmid = {41772970},
issn = {1477-9145},
abstract = {Atmospheric oxygen, which is essential for energy metabolism, can directly influence an animal's heat tolerance by affecting oxygen transport processes, especially in those living in oxygen-poor environments such as plant tissues, underground or aquatic environments. Yet, oxygen availability and heat tolerance are rarely studied together, limiting our ability to predict their combined effects on insect performance. This study examines the larval tolerance of a large xylophagous cerambycid beetle Cacosceles newmannii to combined hypoxic and thermal stress using performance assays (duration of righting response) coupled with metabolomic and transcriptomic analyses. Metabolomic profiling showed that most metabolites were downregulated in the body but upregulated in the haemolymph as stress increased. Transcriptomic profiles clustered primarily by temperature (25 °C vs 35 °C), independent of oxygen level. Cacosceles newmannii appeared capable of modulating its performance to reduce the energy costs and physiological damage induced by hypoxia. This suggested a high baseline hypoxia tolerance rather than a rapid plastic (induced) physiological hypoxia response, probably due to the species' endophytic lifestyle. Conversely, thermal stress led to a predictable increase in metabolic activity but did not markedly affect performance, triggering adjustments to maintain cellular functions while limiting the impact of stresses expected under conditions of high temperature, such as desiccation. In short, our study highlights the distinct metabolic pathways mobilised to cope with hypoxic versus thermal stress, emphasizing the importance of integrated approaches in understanding insect responses to environmental challenges. These findings have significant implications for understanding the species' ecology, with applications for pest management and sustainable agriculture in the context of climate change.},
}
RevDate: 2026-03-06
CmpDate: 2026-03-06
Does Increasing Atmospheric Carbon Dioxide Facilitate Plant Invasions?.
Global change biology, 32(3):e70757.
Elevated CO2 alters resource allocation, which should benefit species that produce metabolically expensive specialized metabolites (in orange). Increasing biochemical production will have consequences for plant competition, plant-soil feedbacks, and ecosystem processes, and can create fitness advantages for these species over species that do not produce these chemicals (in black).
Additional Links: PMID-41772881
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41772881,
year = {2026},
author = {Cadotte, MW and Inderjit, and Turner, SC and Midgley, GF},
title = {Does Increasing Atmospheric Carbon Dioxide Facilitate Plant Invasions?.},
journal = {Global change biology},
volume = {32},
number = {3},
pages = {e70757},
pmid = {41772881},
issn = {1365-2486},
support = {386151//Natural Sciences and Engineering Research Council of Canada/ ; },
mesh = {*Carbon Dioxide/analysis/metabolism ; *Introduced Species ; *Atmosphere/chemistry ; Ecosystem ; *Plants/metabolism ; Climate Change ; },
abstract = {Elevated CO2 alters resource allocation, which should benefit species that produce metabolically expensive specialized metabolites (in orange). Increasing biochemical production will have consequences for plant competition, plant-soil feedbacks, and ecosystem processes, and can create fitness advantages for these species over species that do not produce these chemicals (in black).},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Carbon Dioxide/analysis/metabolism
*Introduced Species
*Atmosphere/chemistry
Ecosystem
*Plants/metabolism
Climate Change
RevDate: 2026-03-02
CmpDate: 2026-03-02
Predicting current and future distributions of bird species in South Africa's arid Northern Cape under climate change scenarios: are biomes being crossed?.
Biodiversity data journal, 14:e177882.
Climate change involves rising temperatures and altered precipitation patterns which lead to the contraction, expansion or shift in the ranges of biodiversity. This study employed MaxEnt to predict current and future distributions of three bird species native to South Africa and one invasive species. Future scenarios were modelled for 2050 and 2070 using three pathways: SSP1-2.6, SSP2-4.5 and SSP5-8.5 and four bioclimatic variables. The models showed good performance, with AUC values above 0.7, indicating high predictive accuracy. Comparisons between current ranges and future predictions show species, such as P. purpureus and L. torquatus, moving south-westwards and crossing into new biomes in response to changing climatic conditions. Meanwhile, U. angolensis shows drastic range contraction, with A. tristis showing expansion into arid environments. Across all concentration pathways, for both time periods, all species show expansion into southern arid regions of the Northern Cape. The models suggest that bird species are not only moving to different geographic areas, but are also likely to cross biome boundaries, which may have ecological implications. The study highlights how climate change is a significant driver of changes in bird species distributions and their entry into new biomes. These findings underline the importance of adaptive conservation strategies that consider the dynamic nature of species distributions under climate change.
Additional Links: PMID-41768605
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41768605,
year = {2026},
author = {Appalasamy, M and Parker-Allie, F and Harebottle, DM},
title = {Predicting current and future distributions of bird species in South Africa's arid Northern Cape under climate change scenarios: are biomes being crossed?.},
journal = {Biodiversity data journal},
volume = {14},
number = {},
pages = {e177882},
pmid = {41768605},
issn = {1314-2828},
abstract = {Climate change involves rising temperatures and altered precipitation patterns which lead to the contraction, expansion or shift in the ranges of biodiversity. This study employed MaxEnt to predict current and future distributions of three bird species native to South Africa and one invasive species. Future scenarios were modelled for 2050 and 2070 using three pathways: SSP1-2.6, SSP2-4.5 and SSP5-8.5 and four bioclimatic variables. The models showed good performance, with AUC values above 0.7, indicating high predictive accuracy. Comparisons between current ranges and future predictions show species, such as P. purpureus and L. torquatus, moving south-westwards and crossing into new biomes in response to changing climatic conditions. Meanwhile, U. angolensis shows drastic range contraction, with A. tristis showing expansion into arid environments. Across all concentration pathways, for both time periods, all species show expansion into southern arid regions of the Northern Cape. The models suggest that bird species are not only moving to different geographic areas, but are also likely to cross biome boundaries, which may have ecological implications. The study highlights how climate change is a significant driver of changes in bird species distributions and their entry into new biomes. These findings underline the importance of adaptive conservation strategies that consider the dynamic nature of species distributions under climate change.},
}
RevDate: 2026-03-02
CmpDate: 2026-03-02
The complete chloroplast genome sequence and phylogenetic analysis of an invasive plant Solanum carolinense Linnaeus (Solanaceae) in Korea.
Mitochondrial DNA. Part B, Resources, 11(4):451-456.
Solanum carolinense Linnaeus, belonging to the family Solanaceae, is a perennial herb or subshrub. S. carolinense has become naturalized in Korea as an invasive species, forming a stable population that has grown naturally with native plants for more than 10 years. However, its chloroplast genome structure and complete sequence have not yet been reported. Therefore, we determined the complete chloroplast genome sequence of S. carolinense using genome sequencing, assembly, and annotation. The total length of the chloroplast genome was 155,315 bp with a GC content of 37.6%. It featured a quadripartite structure (a large single-copy region, 86,160 bp; a small single-copy region, 18,459 bp; and two inverted repeat regions, 25,348 bp each). It contains 129 genes, including 84 coding sequences (CDSs), 37 tRNA genes, 8 rRNA genes, and one pseudogene. Phylogenetic analysis of 78 CDSs revealed that S. carolinense is closely related to S. aridum Morong and S. hieronymi Kuntze. These results provide a molecular foundation for phylogenetic and evolutionary studies of the genus Solanum and present a fundamental chloroplast genomic resource for future invasion biology research.
Additional Links: PMID-41767882
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41767882,
year = {2026},
author = {Kim, HB and Jang, JE and Son, DC and Kang, ES},
title = {The complete chloroplast genome sequence and phylogenetic analysis of an invasive plant Solanum carolinense Linnaeus (Solanaceae) in Korea.},
journal = {Mitochondrial DNA. Part B, Resources},
volume = {11},
number = {4},
pages = {451-456},
pmid = {41767882},
issn = {2380-2359},
abstract = {Solanum carolinense Linnaeus, belonging to the family Solanaceae, is a perennial herb or subshrub. S. carolinense has become naturalized in Korea as an invasive species, forming a stable population that has grown naturally with native plants for more than 10 years. However, its chloroplast genome structure and complete sequence have not yet been reported. Therefore, we determined the complete chloroplast genome sequence of S. carolinense using genome sequencing, assembly, and annotation. The total length of the chloroplast genome was 155,315 bp with a GC content of 37.6%. It featured a quadripartite structure (a large single-copy region, 86,160 bp; a small single-copy region, 18,459 bp; and two inverted repeat regions, 25,348 bp each). It contains 129 genes, including 84 coding sequences (CDSs), 37 tRNA genes, 8 rRNA genes, and one pseudogene. Phylogenetic analysis of 78 CDSs revealed that S. carolinense is closely related to S. aridum Morong and S. hieronymi Kuntze. These results provide a molecular foundation for phylogenetic and evolutionary studies of the genus Solanum and present a fundamental chloroplast genomic resource for future invasion biology research.},
}
RevDate: 2026-02-27
Comprehensive study on the performance optimization of hyperspectral unmixing algorithms: A focus on airborne hyperspectral data.
Water research, 296:125560 pii:S0043-1354(26)00243-5 [Epub ahead of print].
Hyperspectral imaging technology captures fine-grained spectral information from the Earth's surface, offering transformative potential in fields such as environmental monitoring, agriculture, and defense. Hyperspectral unmixing (HU), which decomposes each pixel into pure spectral signatures (endmembers) and quantifies their fractional abundances, enables the detection of target materials by estimating the contribution of each endmember. This study applies hyperspectral unmixing techniques to map and classify invasive alien plant species (Ambrosia trifida, Humulus japonicus, and Sicyos angulatus) in the Geumgang Gomanaru region of South Korea. Endmembers were constructed and used for abundance estimation at the pixel level, overcoming the mixed-pixel problem inherent in hyperspectral data. The experimental pipeline consists of: (1) loading and preprocessing airborne hyperspectral data and endmembers (e.g., Savitzky-Golay filtering), (2) training diverse 1D spectral networks including CNN, CBAM, MLPMixer-1D, SpectralFormer, ViT-1D, and Swin-1D, (3) systematic hyperparameter optimization using Optuna with the proposed spectral loss function (a weighted combination of SAD, SID, and MSE), (4) ablation studies to quantify the individual contributions of attention mechanisms and mixing strategies across CNN, Mixer, and Transformer architectures, (5) model comparison through conventional and spectral metrics (SAD, SAM, SID, RMSE, PSNR) combined with a custom weighted evaluation, and (6) interpretability analysis using SHAP and model assessment. By combining airborne hyperspectral imagery with advanced 1D deep learning architectures-CNN, CBAM, MLPMixer-1D, SpectralFormer, ViT-1D, and Swin-1D-this study captures critical spectral variations across the visible, NIR, and SWIR regions reflecting vegetation physiology and structure. MLPMixer-1D achieved the highest performance through effective inter-band channel mixing. Endmember-specific analysis showed water and grassland were most accurately mapped, whereas invasive species exhibited moderate accuracy due to spectral overlap. SHAP analysis identified UV-A, red-edge, and SWIR bands as most informative for invasive species discrimination, highlighting the ecological and physiological relevance of the spectral features. Overall, integrating hyperspectral sensing with tailored deep learning models offers a powerful framework for resolving mixed pixels and supporting large-scale ecological monitoring of invasive plant species. Our data and code are available at https://drive.google.com/file/d/111g4Sbt7NcmYBcUVK_cbiPSt3h1meLHs/view?usp=drive_link.
Additional Links: PMID-41759318
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41759318,
year = {2026},
author = {Ahn, JM and Lee, H and Kim, K},
title = {Comprehensive study on the performance optimization of hyperspectral unmixing algorithms: A focus on airborne hyperspectral data.},
journal = {Water research},
volume = {296},
number = {},
pages = {125560},
doi = {10.1016/j.watres.2026.125560},
pmid = {41759318},
issn = {1879-2448},
abstract = {Hyperspectral imaging technology captures fine-grained spectral information from the Earth's surface, offering transformative potential in fields such as environmental monitoring, agriculture, and defense. Hyperspectral unmixing (HU), which decomposes each pixel into pure spectral signatures (endmembers) and quantifies their fractional abundances, enables the detection of target materials by estimating the contribution of each endmember. This study applies hyperspectral unmixing techniques to map and classify invasive alien plant species (Ambrosia trifida, Humulus japonicus, and Sicyos angulatus) in the Geumgang Gomanaru region of South Korea. Endmembers were constructed and used for abundance estimation at the pixel level, overcoming the mixed-pixel problem inherent in hyperspectral data. The experimental pipeline consists of: (1) loading and preprocessing airborne hyperspectral data and endmembers (e.g., Savitzky-Golay filtering), (2) training diverse 1D spectral networks including CNN, CBAM, MLPMixer-1D, SpectralFormer, ViT-1D, and Swin-1D, (3) systematic hyperparameter optimization using Optuna with the proposed spectral loss function (a weighted combination of SAD, SID, and MSE), (4) ablation studies to quantify the individual contributions of attention mechanisms and mixing strategies across CNN, Mixer, and Transformer architectures, (5) model comparison through conventional and spectral metrics (SAD, SAM, SID, RMSE, PSNR) combined with a custom weighted evaluation, and (6) interpretability analysis using SHAP and model assessment. By combining airborne hyperspectral imagery with advanced 1D deep learning architectures-CNN, CBAM, MLPMixer-1D, SpectralFormer, ViT-1D, and Swin-1D-this study captures critical spectral variations across the visible, NIR, and SWIR regions reflecting vegetation physiology and structure. MLPMixer-1D achieved the highest performance through effective inter-band channel mixing. Endmember-specific analysis showed water and grassland were most accurately mapped, whereas invasive species exhibited moderate accuracy due to spectral overlap. SHAP analysis identified UV-A, red-edge, and SWIR bands as most informative for invasive species discrimination, highlighting the ecological and physiological relevance of the spectral features. Overall, integrating hyperspectral sensing with tailored deep learning models offers a powerful framework for resolving mixed pixels and supporting large-scale ecological monitoring of invasive plant species. Our data and code are available at https://drive.google.com/file/d/111g4Sbt7NcmYBcUVK_cbiPSt3h1meLHs/view?usp=drive_link.},
}
RevDate: 2026-03-01
CmpDate: 2026-02-27
Plant Invasions in Mountain Areas: Global and Mediterranean Perspectives.
Plants (Basel, Switzerland), 15(4):.
Biological invasions are among the most pervasive threats to biodiversity, ecosystem functioning, and human well-being. Despite international policy efforts, the number of introductions continues to rise worldwide. Mountains, once considered resistant to biological invasions due to harsh climates and isolation, are becoming increasingly vulnerable. Human activities-tourism, infrastructure development, and land-use change-combined with climate warming, are creating new pathways and suitable conditions for non-native plants to spread upslope. Global evidence shows a rapid increase in alien species richness in mountain ecosystems, with some taxa shifting elevation by hundreds of meters. The problem of biological invasions becomes critical when considering that mountains harbor nearly a quarter of the planet's total biodiversity. This issue is even more concerning in biodiversity hotspots such as the Mediterranean Basin, where mountains present an exceptionally high rate of endemism and have served as glacial refugia. The Pyrenees exemplify this dynamic: historically shaped by millennia of human activity, they now face growing pressures from tourism and climate change. Recent cataloging efforts reveal 771 alien taxa, surpassing figures for larger ranges like the Alps. These findings challenge long-held assumptions about mountain resilience and underscore the urgent need for coordinated monitoring, early detection, and management strategies-including citizen science initiatives-to mitigate ecological impacts and protect mountain biodiversity under accelerating global change.
Additional Links: PMID-41754295
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41754295,
year = {2026},
author = {Nualart, N and Martínez-Fuentes, J and López-Guillén, E and López-Pujol, J},
title = {Plant Invasions in Mountain Areas: Global and Mediterranean Perspectives.},
journal = {Plants (Basel, Switzerland)},
volume = {15},
number = {4},
pages = {},
pmid = {41754295},
issn = {2223-7747},
support = {EFA322/19//European Cross-Border Territorial Cooperation Program "Interreg V-A" SPAIN-FRANCE-ANDORRA/ ; EFA064/01//European Cross-Border Territorial Cooperation Program "Interreg V-A" SPAIN-FRANCE-ANDORRA/ ; 2021-SGR00315//Generalitat de Catalunya/ ; },
abstract = {Biological invasions are among the most pervasive threats to biodiversity, ecosystem functioning, and human well-being. Despite international policy efforts, the number of introductions continues to rise worldwide. Mountains, once considered resistant to biological invasions due to harsh climates and isolation, are becoming increasingly vulnerable. Human activities-tourism, infrastructure development, and land-use change-combined with climate warming, are creating new pathways and suitable conditions for non-native plants to spread upslope. Global evidence shows a rapid increase in alien species richness in mountain ecosystems, with some taxa shifting elevation by hundreds of meters. The problem of biological invasions becomes critical when considering that mountains harbor nearly a quarter of the planet's total biodiversity. This issue is even more concerning in biodiversity hotspots such as the Mediterranean Basin, where mountains present an exceptionally high rate of endemism and have served as glacial refugia. The Pyrenees exemplify this dynamic: historically shaped by millennia of human activity, they now face growing pressures from tourism and climate change. Recent cataloging efforts reveal 771 alien taxa, surpassing figures for larger ranges like the Alps. These findings challenge long-held assumptions about mountain resilience and underscore the urgent need for coordinated monitoring, early detection, and management strategies-including citizen science initiatives-to mitigate ecological impacts and protect mountain biodiversity under accelerating global change.},
}
RevDate: 2026-03-01
CmpDate: 2026-02-27
Contrasting Invasion Strategies, Convergent Outcomes: Establishment of Zaprionus tuberculatus and Ceroplastes ceriferus in Italy.
Insects, 17(2):.
Global warming and international trade are accelerating biological invasions, making the Mediterranean basin a hotspot for alien arthropods. Two invasive species, the drosophilid Zaprionus tuberculatus and the wax scale Ceroplastes ceriferus, were recently detected in central-southern Italy. Surveys conducted between 2023 and 2024 detected Z. tuberculatus across several sites in Campania and Lazio, and C. ceriferus in Campania. Zaprionus tuberculatus was reared from ten host plants, including three new records, and reached its highest abundance on persimmon. Laboratory assays showed that Z. tuberculatus adults reproduced only on intact fig fruits and blueberry, indicating a limited risk for most crops. Ceroplastes ceriferus was found on four hosts, confirming its polyphagy and establishment in southern Italy. Molecular analyses revealed two COI haplotypes in the Italian populations of both species, while three haplotypes were detected globally in Z. tuberculatus and seven in C. ceriferus. Sequence divergences were moderate, indicating limited but appreciable mitochondrial differentiation among geographic populations. In Z. tuberculatus, the COII haplotype detected in Italy did not match available African sequences, underscoring gaps in reference data and complicating the reconstruction of invasion routes. Despite contrasting ecological traits and dispersal strategies, both species achieved successful establishment in Italy, showing that ecological plasticity and human-mediated transport can offset reduced genetic diversity. These records expand the known European range of both species and highlight the need for coordinated surveillance, genetic monitoring, and preventive measures to limit further introductions in the Mediterranean region.
Additional Links: PMID-41752601
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41752601,
year = {2026},
author = {Nugnes, F and Carbone, C and Miele, F and Pica, F and Pierro, S and Sasso, R and Bodini, M and Bernardo, U},
title = {Contrasting Invasion Strategies, Convergent Outcomes: Establishment of Zaprionus tuberculatus and Ceroplastes ceriferus in Italy.},
journal = {Insects},
volume = {17},
number = {2},
pages = {},
pmid = {41752601},
issn = {2075-4450},
support = {no number assigned//Regione Campania/ ; },
abstract = {Global warming and international trade are accelerating biological invasions, making the Mediterranean basin a hotspot for alien arthropods. Two invasive species, the drosophilid Zaprionus tuberculatus and the wax scale Ceroplastes ceriferus, were recently detected in central-southern Italy. Surveys conducted between 2023 and 2024 detected Z. tuberculatus across several sites in Campania and Lazio, and C. ceriferus in Campania. Zaprionus tuberculatus was reared from ten host plants, including three new records, and reached its highest abundance on persimmon. Laboratory assays showed that Z. tuberculatus adults reproduced only on intact fig fruits and blueberry, indicating a limited risk for most crops. Ceroplastes ceriferus was found on four hosts, confirming its polyphagy and establishment in southern Italy. Molecular analyses revealed two COI haplotypes in the Italian populations of both species, while three haplotypes were detected globally in Z. tuberculatus and seven in C. ceriferus. Sequence divergences were moderate, indicating limited but appreciable mitochondrial differentiation among geographic populations. In Z. tuberculatus, the COII haplotype detected in Italy did not match available African sequences, underscoring gaps in reference data and complicating the reconstruction of invasion routes. Despite contrasting ecological traits and dispersal strategies, both species achieved successful establishment in Italy, showing that ecological plasticity and human-mediated transport can offset reduced genetic diversity. These records expand the known European range of both species and highlight the need for coordinated surveillance, genetic monitoring, and preventive measures to limit further introductions in the Mediterranean region.},
}
RevDate: 2026-03-01
CmpDate: 2026-02-27
Aphids (Hemiptera: Aphididae) in Living Collections of Selected European Botanic Gardens: Diversity, Biosecurity Challenges, and Sentinel Insights.
Insects, 17(2):.
Botanic gardens host diverse living plant collections and are increasingly recognized as sentinel sites for documenting insect biodiversity and detecting biological invasions. Aphids (Hemiptera: Aphididae) are well suited to such monitoring due to their close host associations, rapid population growth, and importance as horticultural pests and virus vectors. Here, we document the aphid fauna recorded in five European botanic gardens-Zabrze (Poland), Meise (Belgium), and the Royal Botanic Gardens in Edinburgh, Benmore, and Logan (UK)-based on surveys conducted in 2022 and 2023. Sampling approaches included short-duration expert bioblitz-style surveys and extended seasonal monitoring. In total, more than one hundred aphid species were recorded across all sites. Observed species lists differed among gardens and survey periods, reflecting variation in sampling timing, intensity, and host plant composition. Several alien aphid species to Europe of Oriental and Nearctic origin were detected, including multiple new national records. Alien taxa were found both in outdoor living collections and in controlled environments such as glasshouses, nurseries, restricted areas, and plant shops, which may function as entry points as well as locations for early intervention. These findings illustrate the value of botanic gardens for documenting aphid diversity and supporting early detection of non-native species relevant to plant health and biosecurity.
Additional Links: PMID-41752599
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41752599,
year = {2026},
author = {Wieczorek, K and Chłond, D and Ball, K and Zawisza-Raszka, A and Bauters, K and Baert, D and Elliot, M},
title = {Aphids (Hemiptera: Aphididae) in Living Collections of Selected European Botanic Gardens: Diversity, Biosecurity Challenges, and Sentinel Insights.},
journal = {Insects},
volume = {17},
number = {2},
pages = {},
pmid = {41752599},
issn = {2075-4450},
support = {BE-TAF and GB-TAF-8462//SYNTHESYS/ ; },
abstract = {Botanic gardens host diverse living plant collections and are increasingly recognized as sentinel sites for documenting insect biodiversity and detecting biological invasions. Aphids (Hemiptera: Aphididae) are well suited to such monitoring due to their close host associations, rapid population growth, and importance as horticultural pests and virus vectors. Here, we document the aphid fauna recorded in five European botanic gardens-Zabrze (Poland), Meise (Belgium), and the Royal Botanic Gardens in Edinburgh, Benmore, and Logan (UK)-based on surveys conducted in 2022 and 2023. Sampling approaches included short-duration expert bioblitz-style surveys and extended seasonal monitoring. In total, more than one hundred aphid species were recorded across all sites. Observed species lists differed among gardens and survey periods, reflecting variation in sampling timing, intensity, and host plant composition. Several alien aphid species to Europe of Oriental and Nearctic origin were detected, including multiple new national records. Alien taxa were found both in outdoor living collections and in controlled environments such as glasshouses, nurseries, restricted areas, and plant shops, which may function as entry points as well as locations for early intervention. These findings illustrate the value of botanic gardens for documenting aphid diversity and supporting early detection of non-native species relevant to plant health and biosecurity.},
}
RevDate: 2026-03-01
CmpDate: 2026-02-27
Cold Storage Extends Larval Release Windows of Archanara neurica and Lenisa geminipuncta (Noctuidae), Biological Control Agents for Phragmites australis australis.
Insects, 17(2):.
Two biological control agents, Archanara neurica (Hübner) and Lenisa geminipuncta (Haworth) (Lepidoptera: Noctuidae), are being released in Canada for the control of invasive common reed, Phragmites australis australis (Cav.) Trin. Ex Steud (hereafter Phragmites). The release of larvae implanted in cut Phragmites stems is the most reliable way to establish agents at new sites, but the number of larvae that can be used for releases is limited by the short period of time over which egg hatch occurs. We conducted a cold storage experiment to assess whether the timing of egg hatch can be manipulated without affecting hatch success. Additionally, we conducted visual assessments of developing eggs to determine whether hatch timing can be predicted based on early signs of development. Eggs hatched indoors had lower hatch rates than eggs hatched in outdoor conditions. For A. neurica and L. geminipuncta, eggs could be held in cold storage for 11 and 8 weeks, respectively, without affecting hatch rates. Eggs of both species began hatching 4-7 days after the appearance of visible signs of larval development. Manipulating the timing of hatch in A. neurica and L. geminipuncta will increase the number of larval releases that can be conducted during the spring and allow the timing of releases to be optimized.
Additional Links: PMID-41752597
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41752597,
year = {2026},
author = {McTavish, MJ and Jones, IM and Timm, C and Smith, SM and Bourchier, RS},
title = {Cold Storage Extends Larval Release Windows of Archanara neurica and Lenisa geminipuncta (Noctuidae), Biological Control Agents for Phragmites australis australis.},
journal = {Insects},
volume = {17},
number = {2},
pages = {},
pmid = {41752597},
issn = {2075-4450},
support = {J-001762, J-002201//Agriculture and Agri-Food Canada/ ; 0//Ministry of Natural Resources and Forestry/ ; 0//Duck Unlimited Canada/ ; 0//Natural Sciences and Engineering Research Council of Canada/ ; 500232//Invasive Species Centre Canada/ ; },
abstract = {Two biological control agents, Archanara neurica (Hübner) and Lenisa geminipuncta (Haworth) (Lepidoptera: Noctuidae), are being released in Canada for the control of invasive common reed, Phragmites australis australis (Cav.) Trin. Ex Steud (hereafter Phragmites). The release of larvae implanted in cut Phragmites stems is the most reliable way to establish agents at new sites, but the number of larvae that can be used for releases is limited by the short period of time over which egg hatch occurs. We conducted a cold storage experiment to assess whether the timing of egg hatch can be manipulated without affecting hatch success. Additionally, we conducted visual assessments of developing eggs to determine whether hatch timing can be predicted based on early signs of development. Eggs hatched indoors had lower hatch rates than eggs hatched in outdoor conditions. For A. neurica and L. geminipuncta, eggs could be held in cold storage for 11 and 8 weeks, respectively, without affecting hatch rates. Eggs of both species began hatching 4-7 days after the appearance of visible signs of larval development. Manipulating the timing of hatch in A. neurica and L. geminipuncta will increase the number of larval releases that can be conducted during the spring and allow the timing of releases to be optimized.},
}
RevDate: 2026-03-01
CmpDate: 2026-02-27
Microsatellite Data Indicate an Extreme Founder Event with a Single Female Lineage in the Parasitoid Wasp Monodontomerus obscurus.
Insects, 17(2):.
How many founders are required for insects and other organisms to establish new populations is a fundamental question in invasion biology. We investigated the population establishment process of a parasitoid wasp, Monodontomerus sp., which was first recorded in Japan in 2000. Field surveys conducted in this study showed that the parasitism rate has been increasing in recent years. Morphological and molecular analyses suggested that the parasitoid species is M. obscurus, or a closely related lineage derived from it, which newly invaded Japan. To examine genetic variation during the early stage of invasion, we developed microsatellite DNA markers and conducted population genetic analyses. The results revealed extremely low genetic diversity: most loci were monomorphic, polymorphism was restricted to loci with long repeat motifs, and the allele frequencies of these loci were dominated by single alleles. A minimum spanning network based on microsatellite genotypes exhibited a star-like pattern. These results based on genome-wide microsatellite data indicate that the present population was founded by very few individuals, most likely a single female or an effectively single genetic lineage, and novel genotypes arose through post-invasion mutations. Our study provides rare empirical evidence for single-female founding under natural conditions, and highlights how species-specific life-history and genetic systems can enable successful invasion despite extreme bottlenecks.
Additional Links: PMID-41752593
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41752593,
year = {2026},
author = {Abe, J and Matsuo, K and Tsuchida, K},
title = {Microsatellite Data Indicate an Extreme Founder Event with a Single Female Lineage in the Parasitoid Wasp Monodontomerus obscurus.},
journal = {Insects},
volume = {17},
number = {2},
pages = {},
pmid = {41752593},
issn = {2075-4450},
support = {21K06353//Japan Society for the Promotion of Science/ ; 21KK0267//Japan Society for the Promotion of Science/ ; },
abstract = {How many founders are required for insects and other organisms to establish new populations is a fundamental question in invasion biology. We investigated the population establishment process of a parasitoid wasp, Monodontomerus sp., which was first recorded in Japan in 2000. Field surveys conducted in this study showed that the parasitism rate has been increasing in recent years. Morphological and molecular analyses suggested that the parasitoid species is M. obscurus, or a closely related lineage derived from it, which newly invaded Japan. To examine genetic variation during the early stage of invasion, we developed microsatellite DNA markers and conducted population genetic analyses. The results revealed extremely low genetic diversity: most loci were monomorphic, polymorphism was restricted to loci with long repeat motifs, and the allele frequencies of these loci were dominated by single alleles. A minimum spanning network based on microsatellite genotypes exhibited a star-like pattern. These results based on genome-wide microsatellite data indicate that the present population was founded by very few individuals, most likely a single female or an effectively single genetic lineage, and novel genotypes arose through post-invasion mutations. Our study provides rare empirical evidence for single-female founding under natural conditions, and highlights how species-specific life-history and genetic systems can enable successful invasion despite extreme bottlenecks.},
}
RevDate: 2026-03-01
CmpDate: 2026-02-27
Functional Characterization of Akt, a Serine/Threonine Kinase, in Tuta absoluta: A Key Regulator of Molting, Hormones, and Reproduction with Potential for RNAi Pest Control.
Insects, 17(2):.
Insect insulin signaling plays a central role in regulating development, metamorphosis, and reproduction, yet its mechanistic functions in the tomato leafminer, Tuta absoluta, a globally significant pest, remain poorly understood. This study aimed to elucidate the role of the serine/threonine kinase Akt (TaAkt) in coordinating metamorphosis and female reproductive processes. The TaAkt gene was cloned and characterized, and its spatiotemporal expression was analyzed across various developmental stages and tissues. RNA interference (RNAi) was employed to knock down TaAkt in late pupae and newly emerged females, followed by assessment of pupal-adult eclosion, chitin metabolism, 20-hydroxyecdysone (20E) titer, ovarian development, juvenile hormone (JH) levels, vitellogenin synthesis, and fecundity. Knockdown of TaAkt significantly reduced 20E titers and downregulated the expression of ecdysone biosynthesis and signaling genes, leading to pupal mortality, defective molting, and reduced chitin content. In adult females, TaAkt silencing impaired ovarian growth, decreased JH levels, suppressed vitellogenin production, and reduced egg number and hatching rates. These findings demonstrate that TaAkt exerts pleiotropic control over both metamorphic and reproductive processes in T. absoluta. The study identifies TaAkt as a promising molecular target for RNAi-based pest management strategies, offering a potential approach to simultaneously suppress survival and reproductive capacity in this economically important pest.
Additional Links: PMID-41752586
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41752586,
year = {2026},
author = {Liang, C and Song, J and Xu, K and Wan, F and Smagghe, G and Yang, W},
title = {Functional Characterization of Akt, a Serine/Threonine Kinase, in Tuta absoluta: A Key Regulator of Molting, Hormones, and Reproduction with Potential for RNAi Pest Control.},
journal = {Insects},
volume = {17},
number = {2},
pages = {},
pmid = {41752586},
issn = {2075-4450},
support = {QKHJC-ZK-2022-003//Natural Science Foundation of Guizhou Province/ ; GCC-2023-008//Program of High-level Innovation Talents in Guizhou Province/ ; QJJ-2023-024//Program for Natural Science Research in Guizhou Education Department/ ; },
abstract = {Insect insulin signaling plays a central role in regulating development, metamorphosis, and reproduction, yet its mechanistic functions in the tomato leafminer, Tuta absoluta, a globally significant pest, remain poorly understood. This study aimed to elucidate the role of the serine/threonine kinase Akt (TaAkt) in coordinating metamorphosis and female reproductive processes. The TaAkt gene was cloned and characterized, and its spatiotemporal expression was analyzed across various developmental stages and tissues. RNA interference (RNAi) was employed to knock down TaAkt in late pupae and newly emerged females, followed by assessment of pupal-adult eclosion, chitin metabolism, 20-hydroxyecdysone (20E) titer, ovarian development, juvenile hormone (JH) levels, vitellogenin synthesis, and fecundity. Knockdown of TaAkt significantly reduced 20E titers and downregulated the expression of ecdysone biosynthesis and signaling genes, leading to pupal mortality, defective molting, and reduced chitin content. In adult females, TaAkt silencing impaired ovarian growth, decreased JH levels, suppressed vitellogenin production, and reduced egg number and hatching rates. These findings demonstrate that TaAkt exerts pleiotropic control over both metamorphic and reproductive processes in T. absoluta. The study identifies TaAkt as a promising molecular target for RNAi-based pest management strategies, offering a potential approach to simultaneously suppress survival and reproductive capacity in this economically important pest.},
}
RevDate: 2026-03-01
CmpDate: 2026-02-27
Human Activities and Climate Change Accelerate the Spread Risk of Hyphantria cunea in China.
Insects, 17(2):.
Anthropogenic activities and climate change have accelerated biological invasions, leading to profound ecological, economic, social, and health impacts. The invasive species fall webworm (Hyphantria cunea) has been reported to have outbreaks in areas with climate anomalies and human settlements in recent years, highlighting the necessity to explore the species' suitable habitat and associated future changes. We built an ensemble species distribution model using Random Forest, MaxEnt, and Support Vector Machine, achieving excellent predictive performance (AUC = 0.996). Our results identify human settlement density as the dominant driving factor, with a contribution > 50%, far exceeding climatic and forest structure variables. Therefore, densely urbanized regions such as Beijing-Tianjin-Hebei, the Liaodong Peninsula, and the North China Plain comprise the current highly suitable areas. Future climate projections suggest a continued expansion of the suitable habitat for H. cunea, with the most pronounced growth expected under the high-emission pathway (SSP5-8.5), where human activity is greatest. Such a correlation indicates that highly urbanized regions should be given priority for corresponding monitoring and control measures. As climate warming continues, northeastern China will face escalating invasion risks. Conversely, some regions within the Yangtze River Delta may become less suitable for the habitation of H. cunea. These findings provide insightful guidance for region-specific surveillance, quarantine measures, and the precision management of H. cunea in China.
Additional Links: PMID-41752557
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41752557,
year = {2026},
author = {Duan, M and Ning, J and Wang, G and Xu, Z and Li, S and Zhang, Z and Zhang, L and Zhao, L},
title = {Human Activities and Climate Change Accelerate the Spread Risk of Hyphantria cunea in China.},
journal = {Insects},
volume = {17},
number = {2},
pages = {},
pmid = {41752557},
issn = {2075-4450},
support = {2025YFC2609102, 2024YFC2607703//the National Key Plan for Scientific Research and Development of China/ ; 32230066, 32400399, U24A201683//the Natural Science Foundation of China/ ; GZC20232652//Postdoctoral Fellowship Program of CPSF/ ; 202401-10//Best candidates project supported by National Forestry and Grassland Administration/ ; 2023IOZ0103, 2023IOZ0203, 2023IOZ0204//Initiative Scientific Research Program, Institute of Zoology, Chinese Academy of Sciences/ ; No.2022-2260//the China Scholarship Council Innovative Talent Program/ ; },
abstract = {Anthropogenic activities and climate change have accelerated biological invasions, leading to profound ecological, economic, social, and health impacts. The invasive species fall webworm (Hyphantria cunea) has been reported to have outbreaks in areas with climate anomalies and human settlements in recent years, highlighting the necessity to explore the species' suitable habitat and associated future changes. We built an ensemble species distribution model using Random Forest, MaxEnt, and Support Vector Machine, achieving excellent predictive performance (AUC = 0.996). Our results identify human settlement density as the dominant driving factor, with a contribution > 50%, far exceeding climatic and forest structure variables. Therefore, densely urbanized regions such as Beijing-Tianjin-Hebei, the Liaodong Peninsula, and the North China Plain comprise the current highly suitable areas. Future climate projections suggest a continued expansion of the suitable habitat for H. cunea, with the most pronounced growth expected under the high-emission pathway (SSP5-8.5), where human activity is greatest. Such a correlation indicates that highly urbanized regions should be given priority for corresponding monitoring and control measures. As climate warming continues, northeastern China will face escalating invasion risks. Conversely, some regions within the Yangtze River Delta may become less suitable for the habitation of H. cunea. These findings provide insightful guidance for region-specific surveillance, quarantine measures, and the precision management of H. cunea in China.},
}
RevDate: 2026-03-01
CmpDate: 2026-02-27
Pheromone-Mediated Social Organization and Pest Management of the Red Imported Fire Ant, Solenopsis invicta: A Review.
Insects, 17(2):.
Pheromone-mediated chemical communication plays a central role in shaping the social organization and ecological success of S. invicta, a globally invasive eusocial insect characterized by a highly developed semiochemical signaling system. This review summarizes recent advances in the chemical ecology of S. invicta, with emphasis on the putative ecological roles of major pheromone classes, current understanding of the molecular and neurobiological basis of pheromone perception and signal processing, and the associations between chemical cues and colony-level social behavior dynamics. Furthermore, we evaluate progress in pheromone-based management approaches, including pheromone-enhanced baits and trail disruption techniques, highlighting both their potential to improve the specificity and efficacy of fire ant management and the current practical limitations for large-scale field applications. Finally, current significant knowledge gaps and challenges are discussed, particularly the partial characterization of pheromone identity, the ambiguous and biological significance of chemical cues, and challenges in applying laboratory research in pest management under field conditions. By linking chemical ecology, neurobiology, and invasion biology to pest management, this review outlines priority directions for future research and provides a theoretical foundation for developing more sustainable, targeted pest control approaches for fire ant management.
Additional Links: PMID-41752552
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41752552,
year = {2026},
author = {Guo, M and Osman, N and Yu, S and Liu, J and Wang, Y and Deng, J},
title = {Pheromone-Mediated Social Organization and Pest Management of the Red Imported Fire Ant, Solenopsis invicta: A Review.},
journal = {Insects},
volume = {17},
number = {2},
pages = {},
pmid = {41752552},
issn = {2075-4450},
support = {2023C02025//Pioneer and Leading Goose R&D Program of Zhejiang/ ; 2024kx0004//Zhejiang Agriculture and Forestry University Student Research Training Program/ ; },
abstract = {Pheromone-mediated chemical communication plays a central role in shaping the social organization and ecological success of S. invicta, a globally invasive eusocial insect characterized by a highly developed semiochemical signaling system. This review summarizes recent advances in the chemical ecology of S. invicta, with emphasis on the putative ecological roles of major pheromone classes, current understanding of the molecular and neurobiological basis of pheromone perception and signal processing, and the associations between chemical cues and colony-level social behavior dynamics. Furthermore, we evaluate progress in pheromone-based management approaches, including pheromone-enhanced baits and trail disruption techniques, highlighting both their potential to improve the specificity and efficacy of fire ant management and the current practical limitations for large-scale field applications. Finally, current significant knowledge gaps and challenges are discussed, particularly the partial characterization of pheromone identity, the ambiguous and biological significance of chemical cues, and challenges in applying laboratory research in pest management under field conditions. By linking chemical ecology, neurobiology, and invasion biology to pest management, this review outlines priority directions for future research and provides a theoretical foundation for developing more sustainable, targeted pest control approaches for fire ant management.},
}
RevDate: 2026-02-26
Intraguild predation alters life histories in Neoseiulus barkeri and Scolothrips takahashii: asymmetric effects on development and reproduction.
Pest management science [Epub ahead of print].
BACKGROUND: Intraguild predation (IGP) regulates predator populations through direct predation and risk effects, shaping the life-history traits of intraguild prey. This study examines the impacts of IGP on life-history traits of two biocontrol agents, Neoseiulus barkeri and Scolothrips takahashii, reared on their shared prey Tetranychus urticae, using age-stage, two-sex life-table analysis and computer simulations.
RESULTS: Life-table analysis revealed that IGP significantly reduced pre-adult survival of both predators. Neoseiulus barkeri developed faster, but exhibited reduced fecundity under IGP, which resulted in declines in its net reproductive rate (R0, from 30.76 to 10.51 offspring per individual), intrinsic rate of increase (r, from 0.2555 to 0.1872 day[-1]), and finite rate of increase (λ, from 1.2911 to 1.2059 day[-1]). Conversely, S. takahashii maintained stable development and fecundity, showing no significant differences in R0, r, λ and mean generation time (T) between IGP and control groups. The net predation rate (C0) of N. barkeri decreased from 381.00 to 172.97 prey per individual, and that of S. takahashii from 416.58 to 25.31, under IGP. Computer simulations indicated that IGP led to smaller populations and reduced predation potential for N. barkeri, whereas S. takahashii showed an increase in both.
CONCLUSION: IGP differentially alters the population parameters and predation capacity of these two species. Neoseiulus barkeri experiences a decline in population growth, whereas S. takahashii benefits from IGP. These findings highlight species-specific adaptive strategies in response to IGP, providing insights for designing compatible multipredator application programs in biological control. © 2026 Society of Chemical Industry.
Additional Links: PMID-41748490
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41748490,
year = {2026},
author = {Liu, M and Wang, M and Yuan, L and Chu, W and Liu, H and Li, Y},
title = {Intraguild predation alters life histories in Neoseiulus barkeri and Scolothrips takahashii: asymmetric effects on development and reproduction.},
journal = {Pest management science},
volume = {},
number = {},
pages = {},
doi = {10.1002/ps.70678},
pmid = {41748490},
issn = {1526-4998},
support = {//National Key R&D Program of China (2023YFD1400600)/ ; //National Natural Science Foundation of China·(32072483)/ ; },
abstract = {BACKGROUND: Intraguild predation (IGP) regulates predator populations through direct predation and risk effects, shaping the life-history traits of intraguild prey. This study examines the impacts of IGP on life-history traits of two biocontrol agents, Neoseiulus barkeri and Scolothrips takahashii, reared on their shared prey Tetranychus urticae, using age-stage, two-sex life-table analysis and computer simulations.
RESULTS: Life-table analysis revealed that IGP significantly reduced pre-adult survival of both predators. Neoseiulus barkeri developed faster, but exhibited reduced fecundity under IGP, which resulted in declines in its net reproductive rate (R0, from 30.76 to 10.51 offspring per individual), intrinsic rate of increase (r, from 0.2555 to 0.1872 day[-1]), and finite rate of increase (λ, from 1.2911 to 1.2059 day[-1]). Conversely, S. takahashii maintained stable development and fecundity, showing no significant differences in R0, r, λ and mean generation time (T) between IGP and control groups. The net predation rate (C0) of N. barkeri decreased from 381.00 to 172.97 prey per individual, and that of S. takahashii from 416.58 to 25.31, under IGP. Computer simulations indicated that IGP led to smaller populations and reduced predation potential for N. barkeri, whereas S. takahashii showed an increase in both.
CONCLUSION: IGP differentially alters the population parameters and predation capacity of these two species. Neoseiulus barkeri experiences a decline in population growth, whereas S. takahashii benefits from IGP. These findings highlight species-specific adaptive strategies in response to IGP, providing insights for designing compatible multipredator application programs in biological control. © 2026 Society of Chemical Industry.},
}
RevDate: 2026-02-28
CmpDate: 2026-02-26
Hepatitis E Virus Exposure Across Multiple Host Species in a Shared Ecosystem in Argentina.
Veterinary sciences, 13(2):.
The hepatitis E virus (HEV) is an emerging multi-host pathogen, with suids being the main reservoir. Humans are primarily infected through the consumption of contaminated water or food. In Argentina, HEV circulation has been confirmed in humans, domestic pigs, wild boar (Sus scrofa), and surface water. In El Palmar National Park, invasive wild boar and axis deer (Axis axis) are controlled, and their meat is released for public consumption, with trimmings and offal frequently fed to dogs. Between 2017 and 2019, we conducted a multi-species serological survey in this protected area to assess HEV exposure in invasive mammals and in dog and human consumers of game meat. We also evaluated associations between seropositivity and environmental variables, as well as behavioral risk factors among game-meat consumers. Total anti-HEV antibodies were detected in 29/75 (38.67%) wild boar, 1/134 (0.75%) deer, 1/18 (5.6%) dogs, and 6/59 (10.17%) humans. A spatial cluster of seropositive wild boar was identified in a low-lying, flood-prone area near the confluence of the El Palmar stream and the Uruguay river, suggesting increased risk of environmental transmission. This is the first report of HEV exposure in wild boar from this park and in axis deer and dogs in Argentina. Participation in culling and game meat handling and consumption may contribute to HEV exposure pathways among humans. These findings improve understanding of HEV epidemiology at the wildlife-domestic animal-human interface and highlight the influence of environmental factors and human behavior on zoonotic virus circulation.
Additional Links: PMID-41745973
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41745973,
year = {2026},
author = {Tammone Santos, A and Rivero, MA and Condorí, WE and Soto, TB and Moran, MC and Caselli, AE and Tisnés, A and Uhart, MM and Gutiérrez, SE and Estein, SM},
title = {Hepatitis E Virus Exposure Across Multiple Host Species in a Shared Ecosystem in Argentina.},
journal = {Veterinary sciences},
volume = {13},
number = {2},
pages = {},
pmid = {41745973},
issn = {2306-7381},
support = {#03/H278-C//Secretaría de Ciencia, Arte y Tecnología (UNCPBA)/ ; PICT 2018-00599//National Agency for the Promotion of Science and Technology (ANPCYT)/ ; },
abstract = {The hepatitis E virus (HEV) is an emerging multi-host pathogen, with suids being the main reservoir. Humans are primarily infected through the consumption of contaminated water or food. In Argentina, HEV circulation has been confirmed in humans, domestic pigs, wild boar (Sus scrofa), and surface water. In El Palmar National Park, invasive wild boar and axis deer (Axis axis) are controlled, and their meat is released for public consumption, with trimmings and offal frequently fed to dogs. Between 2017 and 2019, we conducted a multi-species serological survey in this protected area to assess HEV exposure in invasive mammals and in dog and human consumers of game meat. We also evaluated associations between seropositivity and environmental variables, as well as behavioral risk factors among game-meat consumers. Total anti-HEV antibodies were detected in 29/75 (38.67%) wild boar, 1/134 (0.75%) deer, 1/18 (5.6%) dogs, and 6/59 (10.17%) humans. A spatial cluster of seropositive wild boar was identified in a low-lying, flood-prone area near the confluence of the El Palmar stream and the Uruguay river, suggesting increased risk of environmental transmission. This is the first report of HEV exposure in wild boar from this park and in axis deer and dogs in Argentina. Participation in culling and game meat handling and consumption may contribute to HEV exposure pathways among humans. These findings improve understanding of HEV epidemiology at the wildlife-domestic animal-human interface and highlight the influence of environmental factors and human behavior on zoonotic virus circulation.},
}
RevDate: 2026-02-28
CmpDate: 2026-02-26
Environmental Stress Shaping Oxidative Responses in the Invasive Crayfish Procambarus clarkii from Lake Trasimeno.
Toxics, 14(2):.
Procambarus clarkii (red swamp crayfish) exhibits physiological plasticity that enables adaptation to variable freshwater conditions, such as those in Lake Trasimeno. This study examined whether fluctuations in hydrometric level and associated physicochemical parameters affect oxidative stress responses in the hepatopancreas and abdominal muscle of male and female individuals. Superoxide dismutase, catalase, glutathione peroxidase, and metallothionein reveal tissue, sex, and season-specific differences that indicate adaptive physiological adjustments. Temporal trends were evaluated, and multivariate analyses summarised environmental and metal gradients. Generalised Additive Models (GAMs) were used to explore relationships between oxidative responses and these gradients, with sex as a categorical factor. Associations were identified with hydrometric level, temperature, conductivity, transparency, pH, dissolved oxygen, and metals of biological relevance. These results highlight the remarkable physiological plasticity of P. clarkii, which underpins its success as an invasive species in fluctuating freshwater ecosystems.
Additional Links: PMID-41745811
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41745811,
year = {2026},
author = {Caldaroni, B and La Porta, G and Dörr, AJM and Gentile, R and Futia, S and Ludovisi, A and Pallottini, M and Selvaggi, R and Bruschi, F and Elia, AC},
title = {Environmental Stress Shaping Oxidative Responses in the Invasive Crayfish Procambarus clarkii from Lake Trasimeno.},
journal = {Toxics},
volume = {14},
number = {2},
pages = {},
pmid = {41745811},
issn = {2305-6304},
support = {ID#8283 COD. SIME 2018.0425//Fondazione Cassa di Risparmio di Perugia, Italy/ ; },
abstract = {Procambarus clarkii (red swamp crayfish) exhibits physiological plasticity that enables adaptation to variable freshwater conditions, such as those in Lake Trasimeno. This study examined whether fluctuations in hydrometric level and associated physicochemical parameters affect oxidative stress responses in the hepatopancreas and abdominal muscle of male and female individuals. Superoxide dismutase, catalase, glutathione peroxidase, and metallothionein reveal tissue, sex, and season-specific differences that indicate adaptive physiological adjustments. Temporal trends were evaluated, and multivariate analyses summarised environmental and metal gradients. Generalised Additive Models (GAMs) were used to explore relationships between oxidative responses and these gradients, with sex as a categorical factor. Associations were identified with hydrometric level, temperature, conductivity, transparency, pH, dissolved oxygen, and metals of biological relevance. These results highlight the remarkable physiological plasticity of P. clarkii, which underpins its success as an invasive species in fluctuating freshwater ecosystems.},
}
RevDate: 2026-02-28
Field-Evolved Resistance to Bt Cry Toxins in Lepidopteran Pests: Insights into Multilayered Regulatory Mechanisms and Next-Generation Management Strategies.
Toxins, 18(2):.
Bt Cry toxins remain the cornerstone of transgenic crop protection against Lepidopteran pests, yet field-evolved resistance, particularly in invasive species such as Spodoptera frugiperda and Helicoverpa armigera, can threaten their long-term efficacy. This review presents a comprehensive and unified mechanistic framework that synthesizes current understanding of Bt Cry toxin modes of action and the complex, multilayered regulatory mechanisms of field-evolved resistance. Beyond the classical pore-formation model, emerging evidence highlights signal transduction cascades, immune evasion via suppression of Toll/IMD pathways, and tripartite toxin-host-microbiota interactions that can dynamically modulate protoxin activation and receptor accessibility. Resistance arises from target-site alterations (e.g., ABCC2/ABCC3, Cadherin mutations), altered midgut protease profiles, enhanced immune regeneration, and microbiota-mediated detoxification, orchestrated by transcription factor networks (GATA, FoxA, FTZ-F1), constitutive MAPK hyperactivation (especially MAP4K4-driven cascades), along with preliminary emerging findings on non-coding RNA involvement. Countermeasures now integrate synergistic Cry/Vip pyramiding, CRISPR/Cas9-validated receptor knockouts revealing functional redundancy, Domain III chimerization (e.g., Cry1A.105), phage-assisted continuous evolution (PACE), and the emerging application of AlphaFold3 for structure-guided rational redesign of resistance-breaking variants. Future sustainability hinges on system-level integration of single-cell transcriptomics, midgut-specific CRISPR screens, microbiome engineering, and AI-accelerated protein design to preempt resistance trajectories and secure Bt biotechnology within integrated resistance and pest management frameworks.
Additional Links: PMID-41745726
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41745726,
year = {2026},
author = {Xie, J and He, W and Qiu, M and Lin, J and Shu, H and Wang, J and Liu, L},
title = {Field-Evolved Resistance to Bt Cry Toxins in Lepidopteran Pests: Insights into Multilayered Regulatory Mechanisms and Next-Generation Management Strategies.},
journal = {Toxins},
volume = {18},
number = {2},
pages = {},
pmid = {41745726},
issn = {2072-6651},
support = {32102289//National Natural Science Foundation of China/ ; 2025AFB458//Natural Science Foundation of Hubei Province/ ; T2024039//Hubei Provincial Higher Education Outstanding Young and Middle-aged Scientific and Technological Innovation Team Project/ ; },
abstract = {Bt Cry toxins remain the cornerstone of transgenic crop protection against Lepidopteran pests, yet field-evolved resistance, particularly in invasive species such as Spodoptera frugiperda and Helicoverpa armigera, can threaten their long-term efficacy. This review presents a comprehensive and unified mechanistic framework that synthesizes current understanding of Bt Cry toxin modes of action and the complex, multilayered regulatory mechanisms of field-evolved resistance. Beyond the classical pore-formation model, emerging evidence highlights signal transduction cascades, immune evasion via suppression of Toll/IMD pathways, and tripartite toxin-host-microbiota interactions that can dynamically modulate protoxin activation and receptor accessibility. Resistance arises from target-site alterations (e.g., ABCC2/ABCC3, Cadherin mutations), altered midgut protease profiles, enhanced immune regeneration, and microbiota-mediated detoxification, orchestrated by transcription factor networks (GATA, FoxA, FTZ-F1), constitutive MAPK hyperactivation (especially MAP4K4-driven cascades), along with preliminary emerging findings on non-coding RNA involvement. Countermeasures now integrate synergistic Cry/Vip pyramiding, CRISPR/Cas9-validated receptor knockouts revealing functional redundancy, Domain III chimerization (e.g., Cry1A.105), phage-assisted continuous evolution (PACE), and the emerging application of AlphaFold3 for structure-guided rational redesign of resistance-breaking variants. Future sustainability hinges on system-level integration of single-cell transcriptomics, midgut-specific CRISPR screens, microbiome engineering, and AI-accelerated protein design to preempt resistance trajectories and secure Bt biotechnology within integrated resistance and pest management frameworks.},
}
RevDate: 2026-02-28
CmpDate: 2026-02-26
An Ammonium Transporter Gene Contributes to the Aggressiveness of the Dutch Elm Disease Pathogen Ophiostoma novo-ulmi.
Journal of fungi (Basel, Switzerland), 12(2):.
Molecular mechanisms determining pathogenicity of the Dutch elm disease fungus Ophiostoma novo-ulmi are poorly understood. Prior identification of the pathogenicity locus pat1 prompted a chromosome walking approach to elucidate gene function in this region. Among 17 identified genes, ONUg0282 (amtA) was predicted to encode a high-affinity ammonium transporter. In silico analyses confirmed the presence of four additional amt genes (amtB, amtC, amtD, and amtE) in both O. novo-ulmi and the less aggressive O. ulmi and that amtA and amtB belong to the Saccharomyces cerevisiae mep2 clade. The predicted amtA gene product showed features of Mep2-type transceptors, including amino acid residues corresponding to His-168 and His-318 in Escherichia coli AmtB protein, 11 transmembrane helices, and a conserved 22 amino acid motif immediately downstream of the last transmembrane helix. A knockdown amtA mutant with 25% residual expression was significantly less aggressive than wild-type O. novo-ulmi strain H327 when infecting Ulmus americana × U. parvifolia saplings. Predicted AmtA transporters from two CRISPR-Cas9 knockout mutants contained only five intact transmembrane helices. The ΔamtA mutants retained several wild-type phenotypic traits, including yeast-mycelium dimorphism, but were significantly less aggressive than H327 towards U. americana saplings. We concluded that ONUg0282 is an important determinant of aggressiveness in O. novo-ulmi.
Additional Links: PMID-41745280
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41745280,
year = {2026},
author = {Bernier, L and de Oliveira, TC and Majeau, JA and Plourde, KV and Jacobi, V and Tanguay, P and de la Bastide, PY and Hintz, WE and Porth, IM and Dufour, J and Hessenauer, P and Roden, CA and Laflamme, C and Varlet, L},
title = {An Ammonium Transporter Gene Contributes to the Aggressiveness of the Dutch Elm Disease Pathogen Ophiostoma novo-ulmi.},
journal = {Journal of fungi (Basel, Switzerland)},
volume = {12},
number = {2},
pages = {},
pmid = {41745280},
issn = {2309-608X},
support = {RGPIN-2018-06607//Natural Sciences and Engineering Research Council of Canada/ ; RGPIN-2025-06771//Natural Sciences and Engineering Research Council of Canada/ ; 10106//Genome Canada/Genome British Columbia/Génome Québec/ ; },
abstract = {Molecular mechanisms determining pathogenicity of the Dutch elm disease fungus Ophiostoma novo-ulmi are poorly understood. Prior identification of the pathogenicity locus pat1 prompted a chromosome walking approach to elucidate gene function in this region. Among 17 identified genes, ONUg0282 (amtA) was predicted to encode a high-affinity ammonium transporter. In silico analyses confirmed the presence of four additional amt genes (amtB, amtC, amtD, and amtE) in both O. novo-ulmi and the less aggressive O. ulmi and that amtA and amtB belong to the Saccharomyces cerevisiae mep2 clade. The predicted amtA gene product showed features of Mep2-type transceptors, including amino acid residues corresponding to His-168 and His-318 in Escherichia coli AmtB protein, 11 transmembrane helices, and a conserved 22 amino acid motif immediately downstream of the last transmembrane helix. A knockdown amtA mutant with 25% residual expression was significantly less aggressive than wild-type O. novo-ulmi strain H327 when infecting Ulmus americana × U. parvifolia saplings. Predicted AmtA transporters from two CRISPR-Cas9 knockout mutants contained only five intact transmembrane helices. The ΔamtA mutants retained several wild-type phenotypic traits, including yeast-mycelium dimorphism, but were significantly less aggressive than H327 towards U. americana saplings. We concluded that ONUg0282 is an important determinant of aggressiveness in O. novo-ulmi.},
}
RevDate: 2026-02-28
CmpDate: 2026-02-26
Population Structure and Growth Dynamics of the Invasive Blue Crab Callinectes sapidus in the Loukkos Estuary (Morocco).
Biology, 15(4):.
This study provides the first insights into the biology of the blue crab Callinectes sapidus in the Loukkos Estuary, based on 461 individuals collected between December 2022 and November 2023. Results indicate a well-structured invasive population. Carapace width ranged from 52 to 201 mm (mean ± SD: 121.7 ± 25.4 mm) and total weight from 12 to 512 g (128.2 ± 76.6 g). Morphometric analyses revealed pronounced sexual dimorphism, with males larger and heavier than females. Size structure shifted seasonally, with smaller crabs dominating spring-summer samples and larger crabs in winter. Biometric relationships were significant and indicated negative allometric growth in both sexes. The sex ratio was strongly male-biased (M/F = 2.72). Condition factor varied with season and sex, peaking in summer and reaching minima in autumn. Female maturity exhibited marked seasonality: immature females prevailed from spring to autumn, whereas mature females occurred mainly in winter. Logistic modeling estimated size at 50% maturity (L50) at 126.7 mm carapace width in females. Results suggest that Loukkos Estuary functions primarily as a nursery and growth area for C. sapidus and provide essential baseline information for future monitoring and management of this invasive species.
Additional Links: PMID-41744662
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41744662,
year = {2026},
author = {Touhami, F and Bazairi, H},
title = {Population Structure and Growth Dynamics of the Invasive Blue Crab Callinectes sapidus in the Loukkos Estuary (Morocco).},
journal = {Biology},
volume = {15},
number = {4},
pages = {},
pmid = {41744662},
issn = {2079-7737},
abstract = {This study provides the first insights into the biology of the blue crab Callinectes sapidus in the Loukkos Estuary, based on 461 individuals collected between December 2022 and November 2023. Results indicate a well-structured invasive population. Carapace width ranged from 52 to 201 mm (mean ± SD: 121.7 ± 25.4 mm) and total weight from 12 to 512 g (128.2 ± 76.6 g). Morphometric analyses revealed pronounced sexual dimorphism, with males larger and heavier than females. Size structure shifted seasonally, with smaller crabs dominating spring-summer samples and larger crabs in winter. Biometric relationships were significant and indicated negative allometric growth in both sexes. The sex ratio was strongly male-biased (M/F = 2.72). Condition factor varied with season and sex, peaking in summer and reaching minima in autumn. Female maturity exhibited marked seasonality: immature females prevailed from spring to autumn, whereas mature females occurred mainly in winter. Logistic modeling estimated size at 50% maturity (L50) at 126.7 mm carapace width in females. Results suggest that Loukkos Estuary functions primarily as a nursery and growth area for C. sapidus and provide essential baseline information for future monitoring and management of this invasive species.},
}
RevDate: 2026-02-28
CmpDate: 2026-02-26
The Impact of Significant Geographical Barriers on the Invasion Risk of Non-Native Aquatic Animals: A Case Study of the Qinling Mountains, China.
Biology, 15(4):.
Biological invasion is a major driver of biodiversity loss and ecosystem disruption, with non-native aquatic species threatening ecological integrity and economic stability. The Qinling Mountains, located in central China, serve as a crucial barrier between temperate and subtropical climate zones, and separate the Yellow and Yangtze River basins. This study investigates the role of these geographical barriers in regulating the distribution and invasion risk of non-native aquatic species. We identified 27 non-native species in Shaanxi Province based on occurrence records compiled from field survey conducted between 2012 and 2024 (and from 2019 to 2024 in the Yellow River mainstream of the Shanxi-Shaanxi Gorge), including 13 high-risk species, such as Trachemys scripta elegans, Procambarus clarkii, Sander lucioperca, and Hypomesus olidus. Using the Aquatic Species Invasiveness Screening Kit and species distribution models, we identified the Hanjiang River in the Yangtze basin and Weihe River estuary in the Yellow River basin as high-risk areas for these species. Mean annual temperature was the primary environmental factor influencing species distribution, with species adapted to cooler conditions predominantly found north of the Qinling Mountains, while those preferring warmer climates are more common in the south. Our findings highlight the Qinling Mountains as both a physical and climatic barrier, limiting cross-basin dispersal and creating distinct invasion patterns. However, human activities such as inter-basin water-transfer projects, damming, and aquaculture practices have gradually weakened the barrier's effectiveness, facilitating the spread of invasive species. We recommend prioritizing monitoring efforts in cross-basin water-transfer regions, focusing on high-risk species adapted to both cooler and warmer climates, and incorporating environmental DNA (eDNA)-based monitoring in recipient areas of inter-basin water-transfer projects for early detection and control to minimize ecosystem damage.
Additional Links: PMID-41744638
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41744638,
year = {2026},
author = {Wang, X and Tian, C and Jia, X and Zhao, Y and Xing, Y},
title = {The Impact of Significant Geographical Barriers on the Invasion Risk of Non-Native Aquatic Animals: A Case Study of the Qinling Mountains, China.},
journal = {Biology},
volume = {15},
number = {4},
pages = {},
pmid = {41744638},
issn = {2079-7737},
support = {NSFC 32373133//National Natural Science Foundation of China/ ; Yellow River Fisheries Resources and Environmental Survey//Ministry of Agriculture and Rural Affairs of the People's Republic of China/ ; NSFC32270464//National Natural Science Foundation of China/ ; Sino BON - Inland Water Fish Diversity Observation Network//Sino BON - Inland Water Fish Diversity Observation Network/ ; },
abstract = {Biological invasion is a major driver of biodiversity loss and ecosystem disruption, with non-native aquatic species threatening ecological integrity and economic stability. The Qinling Mountains, located in central China, serve as a crucial barrier between temperate and subtropical climate zones, and separate the Yellow and Yangtze River basins. This study investigates the role of these geographical barriers in regulating the distribution and invasion risk of non-native aquatic species. We identified 27 non-native species in Shaanxi Province based on occurrence records compiled from field survey conducted between 2012 and 2024 (and from 2019 to 2024 in the Yellow River mainstream of the Shanxi-Shaanxi Gorge), including 13 high-risk species, such as Trachemys scripta elegans, Procambarus clarkii, Sander lucioperca, and Hypomesus olidus. Using the Aquatic Species Invasiveness Screening Kit and species distribution models, we identified the Hanjiang River in the Yangtze basin and Weihe River estuary in the Yellow River basin as high-risk areas for these species. Mean annual temperature was the primary environmental factor influencing species distribution, with species adapted to cooler conditions predominantly found north of the Qinling Mountains, while those preferring warmer climates are more common in the south. Our findings highlight the Qinling Mountains as both a physical and climatic barrier, limiting cross-basin dispersal and creating distinct invasion patterns. However, human activities such as inter-basin water-transfer projects, damming, and aquaculture practices have gradually weakened the barrier's effectiveness, facilitating the spread of invasive species. We recommend prioritizing monitoring efforts in cross-basin water-transfer regions, focusing on high-risk species adapted to both cooler and warmer climates, and incorporating environmental DNA (eDNA)-based monitoring in recipient areas of inter-basin water-transfer projects for early detection and control to minimize ecosystem damage.},
}
RevDate: 2026-02-26
CmpDate: 2026-02-26
A Practical Guide for Harnessing Phylogenomics in Biocontrol: Accounting for Topological Uncertainty and Phylogenetic Distance in the Centrifugal Phylogenetic Method and Beyond.
Evolutionary applications, 19(2):e70203.
In the genomic era, phylogenomics is playing an increasingly important role in biological control research for prioritising species in host specificity testing, species delimitation, and elucidating the origins of introduced species. This paper outlines key concepts in phylogenomics relevant to biocontrol practitioners and provides practical guidance on the construction and interpretation of phylogenetic trees. We examine the patterns and distributions of degrees of separation and phylogenetic distance (also known as patristic distance) across different types of phylogenetic trees, including cladograms, phylograms, and chronograms, and offer recommendations for their application. Further, we consider the impact of topological uncertainty on these distance measures and the inferences they inform for decision-making in biological control. These concepts are illustrated through two case study datasets representing distinct evolutionary contexts. The first explores a recently published phylogeny of Asteraceae tribe Senecioneae derived from traditionally used nuclear and chloroplast Sanger molecular markers, using common groundsel (Senecio vulgaris) as the hypothetical target weed. The second case study dataset focuses on the biocontrol of stinking passionflower (Passiflora foetida) in Australia, presenting a novel target capture (Angiosperms353) phylogeny for this group. Equipping biocontrol practitioners with a deeper understanding of phylogenomics will facilitate more efficient and data-driven decision-making in biological control.
Additional Links: PMID-41744027
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41744027,
year = {2026},
author = {Chen, SH and Rafter, M and Gooden, B and Schmidt-Lebuhn, AN},
title = {A Practical Guide for Harnessing Phylogenomics in Biocontrol: Accounting for Topological Uncertainty and Phylogenetic Distance in the Centrifugal Phylogenetic Method and Beyond.},
journal = {Evolutionary applications},
volume = {19},
number = {2},
pages = {e70203},
pmid = {41744027},
issn = {1752-4571},
abstract = {In the genomic era, phylogenomics is playing an increasingly important role in biological control research for prioritising species in host specificity testing, species delimitation, and elucidating the origins of introduced species. This paper outlines key concepts in phylogenomics relevant to biocontrol practitioners and provides practical guidance on the construction and interpretation of phylogenetic trees. We examine the patterns and distributions of degrees of separation and phylogenetic distance (also known as patristic distance) across different types of phylogenetic trees, including cladograms, phylograms, and chronograms, and offer recommendations for their application. Further, we consider the impact of topological uncertainty on these distance measures and the inferences they inform for decision-making in biological control. These concepts are illustrated through two case study datasets representing distinct evolutionary contexts. The first explores a recently published phylogeny of Asteraceae tribe Senecioneae derived from traditionally used nuclear and chloroplast Sanger molecular markers, using common groundsel (Senecio vulgaris) as the hypothetical target weed. The second case study dataset focuses on the biocontrol of stinking passionflower (Passiflora foetida) in Australia, presenting a novel target capture (Angiosperms353) phylogeny for this group. Equipping biocontrol practitioners with a deeper understanding of phylogenomics will facilitate more efficient and data-driven decision-making in biological control.},
}
RevDate: 2026-02-26
CmpDate: 2026-02-26
Predicting the Potential Distribution of the Invasive Plant Alternanthera pungens Kunth Under Climate Change Scenarios in China.
Ecology and evolution, 16(2):e73124.
Alternanthera pungens Kunth is considered to be less invasive compared to its exotic congener A. philoxeroides (Mart.) Griseb. However, in recent 10 years, it has spread rapidly in Yunnan Province, China. To better understand the species' invasion and distribution, we simulated the potential distribution of A. pungens in China using a MaxEnt model under the current climate scenario and several future climate scenarios, with varying emissions and time frames. The model achieved excellent prediction performance, with A. pungens having an area under the curve value and true skill statistics value of 0.979 and 0.910, respectively. Temperature seasonality and mean temperature of coldest quarter were the greatest predictive environmental variables, with a cumulative contribution of more than 85.3% and a cumulative permutation importance of more than 89.8%. The suitable geographic region of A. pungens is concentrated in southern China. Under the current climate scenarios, projected areas ranked as highly and moderately suitable for A. pungens accounted for 0.31% and 1.03% of the Chinese mainland area, respectively. Under future climate scenarios, the suitable areas for A. pungens in China will expand northwards, with a maximum projected growth rate of 41.4% in the 2070s. This study was the first to show that A. pungens is predicted to expand its range in China in the future. Early warning and monitoring of A. pungens should be pursued, with greater vigilance in southern China to prevent its further spread and invasion.
Additional Links: PMID-41743574
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41743574,
year = {2026},
author = {Zheng, F and Zhang, W and Li, Q and Wang, Z and Xu, G and Clements, DR and Yao, B and Jin, G and Yang, S and Shen, S and Zhang, F and Day, MD},
title = {Predicting the Potential Distribution of the Invasive Plant Alternanthera pungens Kunth Under Climate Change Scenarios in China.},
journal = {Ecology and evolution},
volume = {16},
number = {2},
pages = {e73124},
pmid = {41743574},
issn = {2045-7758},
abstract = {Alternanthera pungens Kunth is considered to be less invasive compared to its exotic congener A. philoxeroides (Mart.) Griseb. However, in recent 10 years, it has spread rapidly in Yunnan Province, China. To better understand the species' invasion and distribution, we simulated the potential distribution of A. pungens in China using a MaxEnt model under the current climate scenario and several future climate scenarios, with varying emissions and time frames. The model achieved excellent prediction performance, with A. pungens having an area under the curve value and true skill statistics value of 0.979 and 0.910, respectively. Temperature seasonality and mean temperature of coldest quarter were the greatest predictive environmental variables, with a cumulative contribution of more than 85.3% and a cumulative permutation importance of more than 89.8%. The suitable geographic region of A. pungens is concentrated in southern China. Under the current climate scenarios, projected areas ranked as highly and moderately suitable for A. pungens accounted for 0.31% and 1.03% of the Chinese mainland area, respectively. Under future climate scenarios, the suitable areas for A. pungens in China will expand northwards, with a maximum projected growth rate of 41.4% in the 2070s. This study was the first to show that A. pungens is predicted to expand its range in China in the future. Early warning and monitoring of A. pungens should be pursued, with greater vigilance in southern China to prevent its further spread and invasion.},
}
RevDate: 2026-02-25
A roadmap to key traits of invasive Drosophilidae.
Biological reviews of the Cambridge Philosophical Society [Epub ahead of print].
Biological invasions have intensified in recent decades, mostly driven by international trade and travel, raising significant concerns, particularly regarding insect pests. Once non-native species establish, they can disrupt natural ecosystem stability, undermine agroecosystem sustainability and cause substantial economic losses. The urgency to anticipate these socio-economic impacts has accelerated research into the traits and processes that predispose certain species to invasion success. Our review examines the factors contributing to invasion success, using the well-documented case of Drosophilidae as a model taxon given the extensive literature on this family. The invasion of Drosophila suzukii is the most well studied, yet it represents just one example among several Drosophilidae successful invasions, including those from the genera Drosophila, Scaptomyza and Zaprionus. Their traits and adaptive capacities have enabled them to overcome environmental barriers, facilitating their global spread and establishment. We first explore the selective forces acting on pioneer individuals and their ability to establish reproducing populations. We then analyse the roles of abiotic factors (through phenotypic plasticity, tolerance to thermal and water stress, synergies between multiple stressors) and biotic factors (through the exploitation of novel trophic niches, resistance to competition and predation, symbiont-mediated assistance) in shaping invasion success. A nuanced understanding of how these constraints interact is essential for predicting and managing the proliferation of invasive Drosophilidae and other non-native species. We propose that successful invasive species do not necessarily excel in one single trait but rather perform adequately across multiple traits and processes. In this review, we found support in the literature for 14 key traits and processes of Drosophilidae biology that facilitate a species' ability to become invasive and provide future perspectives to address critical knowledge gaps, paving the way towards a comprehensive understanding of invasion success.
Additional Links: PMID-41740994
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41740994,
year = {2026},
author = {Deconninck, G and Raynaud-Berton, B and Boulembert, M and Chabrerie, O and Couty, A and Dedeine, F and Eslin, P and Foray, V and Georges, R and Gibert, P and Mouton, L and Pincebourde, S and Renault, D and Suppo, C and Colinet, H},
title = {A roadmap to key traits of invasive Drosophilidae.},
journal = {Biological reviews of the Cambridge Philosophical Society},
volume = {},
number = {},
pages = {},
doi = {10.1002/brv.70148},
pmid = {41740994},
issn = {1469-185X},
support = {ANR-20-CE02-0011//Agence Nationale de la Recherche/ ; //France AgriMer/ ; },
abstract = {Biological invasions have intensified in recent decades, mostly driven by international trade and travel, raising significant concerns, particularly regarding insect pests. Once non-native species establish, they can disrupt natural ecosystem stability, undermine agroecosystem sustainability and cause substantial economic losses. The urgency to anticipate these socio-economic impacts has accelerated research into the traits and processes that predispose certain species to invasion success. Our review examines the factors contributing to invasion success, using the well-documented case of Drosophilidae as a model taxon given the extensive literature on this family. The invasion of Drosophila suzukii is the most well studied, yet it represents just one example among several Drosophilidae successful invasions, including those from the genera Drosophila, Scaptomyza and Zaprionus. Their traits and adaptive capacities have enabled them to overcome environmental barriers, facilitating their global spread and establishment. We first explore the selective forces acting on pioneer individuals and their ability to establish reproducing populations. We then analyse the roles of abiotic factors (through phenotypic plasticity, tolerance to thermal and water stress, synergies between multiple stressors) and biotic factors (through the exploitation of novel trophic niches, resistance to competition and predation, symbiont-mediated assistance) in shaping invasion success. A nuanced understanding of how these constraints interact is essential for predicting and managing the proliferation of invasive Drosophilidae and other non-native species. We propose that successful invasive species do not necessarily excel in one single trait but rather perform adequately across multiple traits and processes. In this review, we found support in the literature for 14 key traits and processes of Drosophilidae biology that facilitate a species' ability to become invasive and provide future perspectives to address critical knowledge gaps, paving the way towards a comprehensive understanding of invasion success.},
}
RevDate: 2026-02-25
CmpDate: 2026-02-25
Many pasts, many futures: Navigating the complexities of species reshuffling to help prevent extinctions.
Cambridge prisms. Extinction, 4:e2.
Preventing human-caused extinctions is a foundational aim of conservation. However, in addition to causing extinctions, humans have moved numerous species to new areas. A considerable percentage of these are threatened in their native ranges. Broadening our conservation ethos to include introduced species is contentious and requires critical thinking in empirical and normative dimensions to negotiate between conflicting conservation goals. Here, we present a series of questions to inspire critical thinking in the negotiation of these conflicts. Empirically, we suggest that conservationists should consider whether the effects of introduced species are due to their non-nativeness per se or are simply a consequence of the organism having a metabolism and taking up space. Importantly, this requires proper scientific comparison to the effects of similar native organisms - otherwise many claims of 'harm' are unfalsifiable and could be used to justify the eradication of any organism. We further propose questions to help conservationists sort facts from normative values, which often wear empirical clothes. Through empirical rigor, value transparency and critical justification of these values, we believe that twenty- first century conservation can become a future-facing and pluralistic discipline with a heightened ability to prevent extinctions in an increasingly unpredictable and novel biosphere.
Additional Links: PMID-41737578
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41737578,
year = {2026},
author = {Lundgren, E and Svenning, JC and Schlaepfer, MA and Wallach, A and Andersson, A and Marris, E and Rohwer, Y and Ramp, D},
title = {Many pasts, many futures: Navigating the complexities of species reshuffling to help prevent extinctions.},
journal = {Cambridge prisms. Extinction},
volume = {4},
number = {},
pages = {e2},
pmid = {41737578},
issn = {2755-0958},
abstract = {Preventing human-caused extinctions is a foundational aim of conservation. However, in addition to causing extinctions, humans have moved numerous species to new areas. A considerable percentage of these are threatened in their native ranges. Broadening our conservation ethos to include introduced species is contentious and requires critical thinking in empirical and normative dimensions to negotiate between conflicting conservation goals. Here, we present a series of questions to inspire critical thinking in the negotiation of these conflicts. Empirically, we suggest that conservationists should consider whether the effects of introduced species are due to their non-nativeness per se or are simply a consequence of the organism having a metabolism and taking up space. Importantly, this requires proper scientific comparison to the effects of similar native organisms - otherwise many claims of 'harm' are unfalsifiable and could be used to justify the eradication of any organism. We further propose questions to help conservationists sort facts from normative values, which often wear empirical clothes. Through empirical rigor, value transparency and critical justification of these values, we believe that twenty- first century conservation can become a future-facing and pluralistic discipline with a heightened ability to prevent extinctions in an increasingly unpredictable and novel biosphere.},
}
RevDate: 2026-02-25
CmpDate: 2026-02-25
A Regional DNA Barcode Library for Northern Rocky Mountain Arthropods to Support Biodiversity and Molecular Ecological Research.
Ecology and evolution, 16(2):e73150.
Arthropod DNA barcode reference libraries have advanced ecological research but remain incomplete in many areas, including the western United States. To improve coverage in the Northern Rocky Mountains, we developed the MPG Ranch Arthropod Library (MPG-AL), a cytochrome oxidase I (COI) DNA barcode reference library for local arthropods in west-central Montana. From 2017 to 2019, we collected 86,533 specimens from various habitats, generating 52,270 DNA barcodes for arthropod taxa from 38 orders, 389 families, 1668 genera, and 1793 species. A comparison of the MPG-AL taxonomic coverage with a combined dataset of publicly accessible Montana arthropod DNA barcodes in the Barcode of Life Database (BOLD) and Montana Natural Heritage Program occurrence records revealed that the MPG-AL added references representing 5154 Barcode Index Numbers (BINs) to BOLD. These additions mark a 280% increase for Montana arthropod DNA barcodes, including 1140 new BINs for taxa previously lacking reference barcode sequences in BOLD. The MPG-AL provides a substantial foundation for establishing a comprehensive arthropod DNA barcode database in the Northern Rocky Mountain ecoregion. However, many taxa still lack reference barcode sequences, particularly in large, diverse insect orders. Future barcoding efforts are encouraged to expand regional taxonomic coverage through targeted sampling and collaborations with regional entomological collections. A comprehensive regional arthropod DNA barcode library will enhance our understanding of arthropod population trends and trophic relationships in the western United States amid persistent threats such as climate change, habitat loss, pesticides, and invasive species.
Additional Links: PMID-41736983
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41736983,
year = {2026},
author = {Seidensticker, MT and Bullington, LS and Morales, SE and Ramsey, PW},
title = {A Regional DNA Barcode Library for Northern Rocky Mountain Arthropods to Support Biodiversity and Molecular Ecological Research.},
journal = {Ecology and evolution},
volume = {16},
number = {2},
pages = {e73150},
pmid = {41736983},
issn = {2045-7758},
abstract = {Arthropod DNA barcode reference libraries have advanced ecological research but remain incomplete in many areas, including the western United States. To improve coverage in the Northern Rocky Mountains, we developed the MPG Ranch Arthropod Library (MPG-AL), a cytochrome oxidase I (COI) DNA barcode reference library for local arthropods in west-central Montana. From 2017 to 2019, we collected 86,533 specimens from various habitats, generating 52,270 DNA barcodes for arthropod taxa from 38 orders, 389 families, 1668 genera, and 1793 species. A comparison of the MPG-AL taxonomic coverage with a combined dataset of publicly accessible Montana arthropod DNA barcodes in the Barcode of Life Database (BOLD) and Montana Natural Heritage Program occurrence records revealed that the MPG-AL added references representing 5154 Barcode Index Numbers (BINs) to BOLD. These additions mark a 280% increase for Montana arthropod DNA barcodes, including 1140 new BINs for taxa previously lacking reference barcode sequences in BOLD. The MPG-AL provides a substantial foundation for establishing a comprehensive arthropod DNA barcode database in the Northern Rocky Mountain ecoregion. However, many taxa still lack reference barcode sequences, particularly in large, diverse insect orders. Future barcoding efforts are encouraged to expand regional taxonomic coverage through targeted sampling and collaborations with regional entomological collections. A comprehensive regional arthropod DNA barcode library will enhance our understanding of arthropod population trends and trophic relationships in the western United States amid persistent threats such as climate change, habitat loss, pesticides, and invasive species.},
}
RevDate: 2026-02-28
Fisher Perceptions and Management Challenges in KwaZulu-Natal's Inland Water Bodies.
Aquatic conservation : marine and freshwater ecosystems, 36(2):e70319.
Inland fisheries in South Africa are crucial for the livelihoods of local communities, but they face pressures that threaten the sustainability of small-scale and recreational fishers livelihoods, the latter making the dominant economic contribution. However, distinctions between small-scale and recreational fishing rights are unclear. We aimed to address the knowledge gap regarding economically significant fish species, their contribution to fishers, and how they are spatial distributed across the uMngeni and uThukela Catchment Management Areas in KwaZulu-Natal, South Africa. Additionally, we addressed the fisher perceptions and use of targetted fish species. A questionnaire-based interview was conducted with fishers between 2021 and 2023 across rivers and impoundments. Our findings highlight several key challenges for inland fisheries management. We found that there are difficulties in categorising fishers, particularly in distinguishing small-scale from recreational fishers, an ambiguity reflected in fishers' self-identifications and practices, with 'subsistence' as a self-identifier. This complexity was further highlighted by the ecological and economic significance of key species, with the invasive Cyprinus carpio having the greatest market value and being the most economically important species. Fishers largely viewed these invasive species through an economic lens, perceiving them as valuable resources and adapting their practices to target their harvest. Regarding fishing behaviours, subsistence fishers were a significant group, reporting weekly or monthly fish consumption and exhibiting a clear preference for river fishing over other waterbody types. Finally, gender significantly influenced participation, with males exhibiting higher fishing frequencies. We conclude that the definitions of inland fisheries in South Africa do not align with the realities on the ground, and the fuzzy boundary between defined small-scale, recreational fisheries and undefined subsistence fishers will likely negatively influence policy implementation. In addition, it highlighted the need for integrated management of South African inland fisheries and economics to sustain inland fisheries that support livelihoods and fish conservation.
Additional Links: PMID-41736723
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41736723,
year = {2026},
author = {Makhathini, N and Burnett, MJ and Hanzen, C and Nkomo, MN and Downs, CT},
title = {Fisher Perceptions and Management Challenges in KwaZulu-Natal's Inland Water Bodies.},
journal = {Aquatic conservation : marine and freshwater ecosystems},
volume = {36},
number = {2},
pages = {e70319},
pmid = {41736723},
issn = {1052-7613},
support = {227749/WT_/Wellcome Trust/United Kingdom ; },
abstract = {Inland fisheries in South Africa are crucial for the livelihoods of local communities, but they face pressures that threaten the sustainability of small-scale and recreational fishers livelihoods, the latter making the dominant economic contribution. However, distinctions between small-scale and recreational fishing rights are unclear. We aimed to address the knowledge gap regarding economically significant fish species, their contribution to fishers, and how they are spatial distributed across the uMngeni and uThukela Catchment Management Areas in KwaZulu-Natal, South Africa. Additionally, we addressed the fisher perceptions and use of targetted fish species. A questionnaire-based interview was conducted with fishers between 2021 and 2023 across rivers and impoundments. Our findings highlight several key challenges for inland fisheries management. We found that there are difficulties in categorising fishers, particularly in distinguishing small-scale from recreational fishers, an ambiguity reflected in fishers' self-identifications and practices, with 'subsistence' as a self-identifier. This complexity was further highlighted by the ecological and economic significance of key species, with the invasive Cyprinus carpio having the greatest market value and being the most economically important species. Fishers largely viewed these invasive species through an economic lens, perceiving them as valuable resources and adapting their practices to target their harvest. Regarding fishing behaviours, subsistence fishers were a significant group, reporting weekly or monthly fish consumption and exhibiting a clear preference for river fishing over other waterbody types. Finally, gender significantly influenced participation, with males exhibiting higher fishing frequencies. We conclude that the definitions of inland fisheries in South Africa do not align with the realities on the ground, and the fuzzy boundary between defined small-scale, recreational fisheries and undefined subsistence fishers will likely negatively influence policy implementation. In addition, it highlighted the need for integrated management of South African inland fisheries and economics to sustain inland fisheries that support livelihoods and fish conservation.},
}
RevDate: 2026-02-24
CmpDate: 2026-02-24
Biogeography: Invasive predators rewire island food webs.
Current biology : CB, 36(4):R145-R147.
A new study shows that invasive American bullfrogs restructure island food webs by displacing native species from central roles, increasing network connectance and reducing modularity. These changes destabilize ecosystems and decouple food-web architecture from classic island biogeography patterns, revealing hidden invader impacts beyond species loss.
Additional Links: PMID-41734750
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41734750,
year = {2026},
author = {Popescu, VD},
title = {Biogeography: Invasive predators rewire island food webs.},
journal = {Current biology : CB},
volume = {36},
number = {4},
pages = {R145-R147},
doi = {10.1016/j.cub.2025.12.062},
pmid = {41734750},
issn = {1879-0445},
mesh = {Animals ; *Food Chain ; *Introduced Species ; Islands ; *Predatory Behavior ; Ecosystem ; },
abstract = {A new study shows that invasive American bullfrogs restructure island food webs by displacing native species from central roles, increasing network connectance and reducing modularity. These changes destabilize ecosystems and decouple food-web architecture from classic island biogeography patterns, revealing hidden invader impacts beyond species loss.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Food Chain
*Introduced Species
Islands
*Predatory Behavior
Ecosystem
RevDate: 2026-02-24
Computational insights into herbicide resistance via acetohydroxyacid synthase in Ambrosia artemisiifolia.
Computational biology and chemistry, 123:108959 pii:S1476-9271(26)00084-8 [Epub ahead of print].
Herbicide resistance poses a major challenge in modern weed management, especially under the pressure of intensive herbicide use and climate-induced stressors. Ambrosia artemisiifolia (common ragweed) is a highly invasive species often controlled by herbicides targeting acetohydroxyacid synthase (AHAS), an enzyme essential for branched-chain amino acid synthesis. Genomic analyses have identified the Trp574Leu mutation as the main driver of resistance to AHAS-inhibiting herbicides. In this study, we employed a suite of in silico techniques, including homology modeling, molecular docking, dynamics simulations, and pharmacophore modeling, to investigate the structural and functional impact of the Trp574Leu mutation in both wild-type and mutant AHAS variants. Key residues in herbicide binding were characterized using molecular dynamics, revealing that the Trp558Leu mutation alters the binding interface by selectively disrupting key wild-type-specific interactions while promoting alternative contacts in the mutant system. Interactions mediated by Ala637, which substantially contribute to the WT binding mode, are markedly reduced in the mutant, whereas contacts involving Arg361 are significantly stabilized. Pharmacophore models were developed for both enzyme variants, with the wild-type model (A1A3A5N12) showing predictive performance (ROC = 0.89, AUAC = 0.88, EF1 % = 7.65) based on cloransulam-methyl binding. A consensus pharmacophore integrating features from both models was constructed to support the rational design of novel herbicides. These results offer molecular-level insights into AHAS-mediated resistance and tools that may aid the rational design of new herbicides capable of overcoming the Trp574Leu resistance mechanism.
Additional Links: PMID-41734661
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41734661,
year = {2026},
author = {Borota, A and Funar-Timofei, S and Neanu, C and Halip, L and Savulescu, R},
title = {Computational insights into herbicide resistance via acetohydroxyacid synthase in Ambrosia artemisiifolia.},
journal = {Computational biology and chemistry},
volume = {123},
number = {},
pages = {108959},
doi = {10.1016/j.compbiolchem.2026.108959},
pmid = {41734661},
issn = {1476-928X},
abstract = {Herbicide resistance poses a major challenge in modern weed management, especially under the pressure of intensive herbicide use and climate-induced stressors. Ambrosia artemisiifolia (common ragweed) is a highly invasive species often controlled by herbicides targeting acetohydroxyacid synthase (AHAS), an enzyme essential for branched-chain amino acid synthesis. Genomic analyses have identified the Trp574Leu mutation as the main driver of resistance to AHAS-inhibiting herbicides. In this study, we employed a suite of in silico techniques, including homology modeling, molecular docking, dynamics simulations, and pharmacophore modeling, to investigate the structural and functional impact of the Trp574Leu mutation in both wild-type and mutant AHAS variants. Key residues in herbicide binding were characterized using molecular dynamics, revealing that the Trp558Leu mutation alters the binding interface by selectively disrupting key wild-type-specific interactions while promoting alternative contacts in the mutant system. Interactions mediated by Ala637, which substantially contribute to the WT binding mode, are markedly reduced in the mutant, whereas contacts involving Arg361 are significantly stabilized. Pharmacophore models were developed for both enzyme variants, with the wild-type model (A1A3A5N12) showing predictive performance (ROC = 0.89, AUAC = 0.88, EF1 % = 7.65) based on cloransulam-methyl binding. A consensus pharmacophore integrating features from both models was constructed to support the rational design of novel herbicides. These results offer molecular-level insights into AHAS-mediated resistance and tools that may aid the rational design of new herbicides capable of overcoming the Trp574Leu resistance mechanism.},
}
RevDate: 2026-02-24
The origins and potential cross-species transmission of paramyxoviruses and other RNA viruses between native snakes and invasive Burmese pythons in the Florida Everglades.
Journal of virology [Epub ahead of print].
UNLABELLED: During November-December 2020, a disease outbreak involving eastern mudsnakes (Farancia abacura abacura) was documented in the Greater Everglades Ecosystem, Florida, USA. Moribund snakes were observed writhing on riverbanks with concomitant frothy oral discharge. Pathological examination revealed necrotizing enteritis and pulmonary edema, and a reptilian ferlavirus phylogenetically related to anaconda paramyxoviruses was isolated. While ferlaviruses are well-described pathogens of snakes in zoological and private collections worldwide, this represented the first outbreak of ferlaviruses recorded in free-ranging snakes. To biologically characterize this virus, we performed in vitro analyses including host range, relative infectivity, and temperature-dependent fitness assays. As one outstanding question in paramyxovirus biology is the functional role of the U protein, which is unique to ferlaviruses, we investigated its spatiotemporal expression in infected cells, demonstrating its localization to viral inclusion bodies. Additionally, we sampled Burmese pythons (Python molurus bivittatus), an invasive constrictor species, in and around the outbreak site in the Everglades for reptilian ferlaviruses, resulting in the discovery of the first terrestrial alphavirus detected in the United States in over 50 years and a novel hepacivirus that putatively contains a third protease which is evolutionarily conserved among lower vertebrate hepaciviruses and may have arisen by duplication of the NS2-3 protease. Although the impact of Burmese pythons on the Everglades ecosystem via the predation of native species has garnered much attention, little is known regarding the diversity of viral pathogens they harbor and the potential risks they may pose to native wildlife and other animal hosts through viral cross-species transmission.
IMPORTANCE: Although the evolution, molecular biology, and pathogenesis of numerous disease-causing animal paramyxoviruses have been examined extensively, studies on reptilian ferlaviruses-which have been responsible for large-scale mortality events in snakes in managed settings for decades-have lagged significantly. Herein, we document the first recognized ferlavirus disease outbreak in free-ranging snakes and provide new insights on the ferlavirus-specific U protein and reptilian host range that make these viruses unique among the paramyxoviruses. In searching for the potential source of ferlaviruses in nature, we discovered other novel RNA viruses in Burmese pythons, an invasive constrictor species introduced into the Everglades. In addition to extending the known diversity of reptilian viruses, these findings provide new fundamental insights into mammalian virus evolution and highlight the potential dangers of the cross-species transmission of such viruses into native snakes and other wildlife.
Additional Links: PMID-41733344
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41733344,
year = {2026},
author = {Shrestha, A and Schwarz, JW and Feng, KH and Spencer, MM and Adhikari, A and Amwe, OO and Sacharia, RG and O'Hanlon, B and Denagamage, T and Weyna, AAW and Nemeth, NM and Holmes, EC and Allison, AB},
title = {The origins and potential cross-species transmission of paramyxoviruses and other RNA viruses between native snakes and invasive Burmese pythons in the Florida Everglades.},
journal = {Journal of virology},
volume = {},
number = {},
pages = {e0183325},
doi = {10.1128/jvi.01833-25},
pmid = {41733344},
issn = {1098-5514},
abstract = {UNLABELLED: During November-December 2020, a disease outbreak involving eastern mudsnakes (Farancia abacura abacura) was documented in the Greater Everglades Ecosystem, Florida, USA. Moribund snakes were observed writhing on riverbanks with concomitant frothy oral discharge. Pathological examination revealed necrotizing enteritis and pulmonary edema, and a reptilian ferlavirus phylogenetically related to anaconda paramyxoviruses was isolated. While ferlaviruses are well-described pathogens of snakes in zoological and private collections worldwide, this represented the first outbreak of ferlaviruses recorded in free-ranging snakes. To biologically characterize this virus, we performed in vitro analyses including host range, relative infectivity, and temperature-dependent fitness assays. As one outstanding question in paramyxovirus biology is the functional role of the U protein, which is unique to ferlaviruses, we investigated its spatiotemporal expression in infected cells, demonstrating its localization to viral inclusion bodies. Additionally, we sampled Burmese pythons (Python molurus bivittatus), an invasive constrictor species, in and around the outbreak site in the Everglades for reptilian ferlaviruses, resulting in the discovery of the first terrestrial alphavirus detected in the United States in over 50 years and a novel hepacivirus that putatively contains a third protease which is evolutionarily conserved among lower vertebrate hepaciviruses and may have arisen by duplication of the NS2-3 protease. Although the impact of Burmese pythons on the Everglades ecosystem via the predation of native species has garnered much attention, little is known regarding the diversity of viral pathogens they harbor and the potential risks they may pose to native wildlife and other animal hosts through viral cross-species transmission.
IMPORTANCE: Although the evolution, molecular biology, and pathogenesis of numerous disease-causing animal paramyxoviruses have been examined extensively, studies on reptilian ferlaviruses-which have been responsible for large-scale mortality events in snakes in managed settings for decades-have lagged significantly. Herein, we document the first recognized ferlavirus disease outbreak in free-ranging snakes and provide new insights on the ferlavirus-specific U protein and reptilian host range that make these viruses unique among the paramyxoviruses. In searching for the potential source of ferlaviruses in nature, we discovered other novel RNA viruses in Burmese pythons, an invasive constrictor species introduced into the Everglades. In addition to extending the known diversity of reptilian viruses, these findings provide new fundamental insights into mammalian virus evolution and highlight the potential dangers of the cross-species transmission of such viruses into native snakes and other wildlife.},
}
RevDate: 2026-02-24
Thermal Plasticity is Regulated by a Key MicroRNA During Range Expansion of an Invasive Fruit Fly.
Advanced science (Weinheim, Baden-Wurttemberg, Germany) [Epub ahead of print].
Understanding the mechanisms that enable invasive species to expand into novel thermal environments is key to predict their future distribution range under climate change. Plasticity is a key driver behind range expansion during invasion, yet the post-transcriptional regulatory mechanism underlying plasticity during range expansion remains less explored. Here, we performed an integr analysis of phenotypic, transcriptomic, and microRNA (miRNA) changes in a range-expanding invasive insect, Bactrocera dorsalis, under heat and cold acclimation. We found that populations at the invasive front exhibited reduced plasticity in fitness-related traits that were corroborated by genetic assimilation of frontloaded genes. Weighted Gene Co-expression Network Analysis uncovered important modules associated with acute cold tolerance of B. dorsalis and indicated thw gene as a critical network component. Furthermore, thw was found to be regulated by a key miRNA, miR-276b, with its function verified by our dual-luciferase reporter assay and RNAi-mediated knockdown experiment. Our findings suggested that miRNA-mediated regulation of plasticity might be key to allow invasive species to expand into novel thermal environments.
Additional Links: PMID-41733030
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41733030,
year = {2026},
author = {Zhao, Y and Hu, J and Du, J and Guo, S and Hou, Y and Li, Z},
title = {Thermal Plasticity is Regulated by a Key MicroRNA During Range Expansion of an Invasive Fruit Fly.},
journal = {Advanced science (Weinheim, Baden-Wurttemberg, Germany)},
volume = {},
number = {},
pages = {e07662},
doi = {10.1002/advs.202507662},
pmid = {41733030},
issn = {2198-3844},
support = {32172394//National Natural Science Foundation of China/ ; SKLJRP2509//Joint Research Program of State Key Laboratory of Agricultural and Forestry Biosecurity/ ; 2021YF1403200//Shanghai Sailing Program/ ; //The Teaching Team Program of China Agricultural University/ ; //The 2115 Talent Development Program of China Agricultural University/ ; },
abstract = {Understanding the mechanisms that enable invasive species to expand into novel thermal environments is key to predict their future distribution range under climate change. Plasticity is a key driver behind range expansion during invasion, yet the post-transcriptional regulatory mechanism underlying plasticity during range expansion remains less explored. Here, we performed an integr analysis of phenotypic, transcriptomic, and microRNA (miRNA) changes in a range-expanding invasive insect, Bactrocera dorsalis, under heat and cold acclimation. We found that populations at the invasive front exhibited reduced plasticity in fitness-related traits that were corroborated by genetic assimilation of frontloaded genes. Weighted Gene Co-expression Network Analysis uncovered important modules associated with acute cold tolerance of B. dorsalis and indicated thw gene as a critical network component. Furthermore, thw was found to be regulated by a key miRNA, miR-276b, with its function verified by our dual-luciferase reporter assay and RNAi-mediated knockdown experiment. Our findings suggested that miRNA-mediated regulation of plasticity might be key to allow invasive species to expand into novel thermal environments.},
}
RevDate: 2026-02-23
The endomicrobiome and weed invasiveness in Mediterranean ecosystems worldwide.
Nature communications pii:10.1038/s41467-026-68826-1 [Epub ahead of print].
Mediterranean ecosystems, one of the most significant global hotspots of biodiversity, are threatened by invasive weeds. Although endomicrobiomes - the vast array of microbes colonising living plant tissues - are known to affect plant fitness, their contribution to weed invasiveness remains virtually unknown. Here, we experimentally assess the role of the endomicrobiome in the invasiveness of Taraxacum officinale (common dandelion), a widespread weed in Mediterranean ecosystems worldwide. In a culling experiment across five generations, we compare the fitness of T. officinale from these ecosystems on five continents grown with intact or reduced native seed-borne endomicrobiomes. Additionally, we report a competition experiment with F1 and F5 individuals assessing their impacts on native local Asteraceae species. We found that T. officinale individuals harboring intact endomicrobiomes show faster and more favorable trait development compared with individuals with reduced endomicrobiomes. Enhanced competitiveness of endomicrobiome-colonised T. officinale plants with local Asteraceae species is apparently caused by increased synthesis of allelochemicals in shoots and rhizosphere soil, with gene expression analyses also showing the endomicrobiome to affect the expression by T. officinale of stress response and RNA-directed DNA methylation genes. Our findings provide insights into the mechanisms underlying weed invasiveness in Mediterranean ecosystems.
Additional Links: PMID-41730892
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41730892,
year = {2026},
author = {Molina-Montenegro, MA and Acuña-Rodríguez, IS and Atala, C and Ballesteros, GI and Carrasco-Urra, F and Castro-Nallar, E and Delgado-Baquerizo, M and Escobedo, VM and Fuentes-Peñailillo, F and García, LY and Guajardo-Leiva, S and Gundel, PE and Hereme, R and Ochoa-Hueso, R and Pertierra, LR and Richardson, DM and Torres-Díaz, C and Ueno, AC and Villalón, A and Zanne, AE and Newsham, KK},
title = {The endomicrobiome and weed invasiveness in Mediterranean ecosystems worldwide.},
journal = {Nature communications},
volume = {},
number = {},
pages = {},
doi = {10.1038/s41467-026-68826-1},
pmid = {41730892},
issn = {2041-1723},
abstract = {Mediterranean ecosystems, one of the most significant global hotspots of biodiversity, are threatened by invasive weeds. Although endomicrobiomes - the vast array of microbes colonising living plant tissues - are known to affect plant fitness, their contribution to weed invasiveness remains virtually unknown. Here, we experimentally assess the role of the endomicrobiome in the invasiveness of Taraxacum officinale (common dandelion), a widespread weed in Mediterranean ecosystems worldwide. In a culling experiment across five generations, we compare the fitness of T. officinale from these ecosystems on five continents grown with intact or reduced native seed-borne endomicrobiomes. Additionally, we report a competition experiment with F1 and F5 individuals assessing their impacts on native local Asteraceae species. We found that T. officinale individuals harboring intact endomicrobiomes show faster and more favorable trait development compared with individuals with reduced endomicrobiomes. Enhanced competitiveness of endomicrobiome-colonised T. officinale plants with local Asteraceae species is apparently caused by increased synthesis of allelochemicals in shoots and rhizosphere soil, with gene expression analyses also showing the endomicrobiome to affect the expression by T. officinale of stress response and RNA-directed DNA methylation genes. Our findings provide insights into the mechanisms underlying weed invasiveness in Mediterranean ecosystems.},
}
RevDate: 2026-02-23
CmpDate: 2026-02-23
Seasonal influence on the efficacy of aquatic macrophytes as potential phytoremediation agents in urban wetlands.
Environmental monitoring and assessment, 198(3):.
Globally, metal contamination raises serious concerns within aquatic ecosystems. In aquatic systems, metal contamination can be removed by phytoremediation. This study assessed the ability of four macrophyte species (i.e. Phragmites australis, Typha capensis, Cyperus papyrus, and Cyperus dives) for phytoremediation of metals from five different wetlands across three seasons (i.e. cool-dry, hot-wet, hot-dry). In addition, this study used the bioconcentration factor (BCF) and translocation factor (TF) to determine the accumulation and translocation of metals within macrophyte species. The study indicated that different macrophytes accumulated different metals within the roots and leaves of all species during the cool-dry followed by hot-dry and hot-wet seasons. The study further indicated high BCF and TF of > 1 in all macrophytes during the cool-dry and hot-dry seasons. Phragmites australis had low accumulation of metals amongst the species studied. The TF was generally > 1, indicating efficient movement of most metals from roots to leaves, particularly during the hot-dry and cool-dry seasons. Cyperus dives and T. capensis exhibited potential as phytoremediation candidates. Aquatic macrophytes in urban wetlands accumulated and translocated metals, indicating their phytoremediation potential. However, elevated concentrations in these macrophytes can pose both ecological and health risks, as they can enter food-chain and can interfere and disrupt key physiological processes like photosynthesis, respiration, and nutrient uptake in these macrophytes. Therefore, regular monitoring of aquatic macrophytes with phytoremediation potential is recommended to enhance wetland health and pollution reduction.
Additional Links: PMID-41729363
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41729363,
year = {2026},
author = {Kola, E and Munyai, C and Mpopetsi, P and Dondofema, F and Munyai, LF and Dalu, T},
title = {Seasonal influence on the efficacy of aquatic macrophytes as potential phytoremediation agents in urban wetlands.},
journal = {Environmental monitoring and assessment},
volume = {198},
number = {3},
pages = {},
pmid = {41729363},
issn = {1573-2959},
support = {FSEA/21/GGES/02//University of Venda/ ; TTK240409213108//National Research Foundation/ ; },
mesh = {*Wetlands ; Biodegradation, Environmental ; *Water Pollutants, Chemical/analysis/metabolism ; Seasons ; Environmental Monitoring ; Cyperus/metabolism ; Typhaceae/metabolism ; Poaceae ; Cities ; },
abstract = {Globally, metal contamination raises serious concerns within aquatic ecosystems. In aquatic systems, metal contamination can be removed by phytoremediation. This study assessed the ability of four macrophyte species (i.e. Phragmites australis, Typha capensis, Cyperus papyrus, and Cyperus dives) for phytoremediation of metals from five different wetlands across three seasons (i.e. cool-dry, hot-wet, hot-dry). In addition, this study used the bioconcentration factor (BCF) and translocation factor (TF) to determine the accumulation and translocation of metals within macrophyte species. The study indicated that different macrophytes accumulated different metals within the roots and leaves of all species during the cool-dry followed by hot-dry and hot-wet seasons. The study further indicated high BCF and TF of > 1 in all macrophytes during the cool-dry and hot-dry seasons. Phragmites australis had low accumulation of metals amongst the species studied. The TF was generally > 1, indicating efficient movement of most metals from roots to leaves, particularly during the hot-dry and cool-dry seasons. Cyperus dives and T. capensis exhibited potential as phytoremediation candidates. Aquatic macrophytes in urban wetlands accumulated and translocated metals, indicating their phytoremediation potential. However, elevated concentrations in these macrophytes can pose both ecological and health risks, as they can enter food-chain and can interfere and disrupt key physiological processes like photosynthesis, respiration, and nutrient uptake in these macrophytes. Therefore, regular monitoring of aquatic macrophytes with phytoremediation potential is recommended to enhance wetland health and pollution reduction.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Wetlands
Biodegradation, Environmental
*Water Pollutants, Chemical/analysis/metabolism
Seasons
Environmental Monitoring
Cyperus/metabolism
Typhaceae/metabolism
Poaceae
Cities
RevDate: 2026-02-23
CmpDate: 2026-02-23
Plant diversity hotspot mapping and identification of vegetation-environment interactions in the western Himalayas.
Environmental monitoring and assessment, 198(3):.
Biodiversity hotspot mapping and documenting vegetation-environment interactions are crucial for effective conservation and management efforts. Spatial patterns of vegetation diversity help in identifying priority areas. The western Himalayan forests of District Bagh, Azad Jammu and Kashmir, Pakistan, harbour rich plant diversity, but limited knowledge of their influencing factors and unidentified priority areas are the major constraints. To fill this knowledge gap, field sampling was conducted from January 2018 to December 2020, with a total of 60 randomly selected sampling sites (540 plots) along the elevation gradient to collect vegetation and environmental data. Multivariate statistical tools were employed to analyse the data. The results depicted that the study area has 382 plant species which belong to five significantly different (p < 0.05) plant associations, each having unique species composition. Canonical correspondence analysis (CCA) results depicted that elevation, annual precipitation, latitude value, available potassium, normalised difference vegetation index (NDVI), and longitude value (in order) were the most influential drivers (p < 0.05) of the vegetation differences. Anthropogenic disturbances like deforestation and grazing pressure were recorded as important factors as well. Shannon's diversity mapping suggests that the central parts of the study area, including the Rangla, Thub, Mallot, Banni Passari, and Jaglari areas, as well as the Lasdana area in the east, were the most diverse (H' > 3) and are key hotspot candidates for conserving local diversity and improving management in the region. This study recorded some non-native plant species, including Sisyrinchium micranthum and Mazus caducifer, for the first time in Pakistan. These invasive species were found to be successfully naturalising; therefore, continuous monitoring of their competitive abilities compared to native flora is necessary.
Additional Links: PMID-41729341
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41729341,
year = {2026},
author = {Iqbal, T and Khan, AM and Habib, T and Saqib, Z and Hussain, K and Zhang, M and Bussmann, RW and Siddiqui, MH},
title = {Plant diversity hotspot mapping and identification of vegetation-environment interactions in the western Himalayas.},
journal = {Environmental monitoring and assessment},
volume = {198},
number = {3},
pages = {},
pmid = {41729341},
issn = {1573-2959},
support = {Ongoing Research Funding program, (ORF-2026-347)//King Saud University, Riyadh, Saudi Arabia/ ; },
mesh = {Pakistan ; *Biodiversity ; *Environmental Monitoring ; *Plants/classification ; Conservation of Natural Resources ; Forests ; Ecosystem ; Himalayas ; },
abstract = {Biodiversity hotspot mapping and documenting vegetation-environment interactions are crucial for effective conservation and management efforts. Spatial patterns of vegetation diversity help in identifying priority areas. The western Himalayan forests of District Bagh, Azad Jammu and Kashmir, Pakistan, harbour rich plant diversity, but limited knowledge of their influencing factors and unidentified priority areas are the major constraints. To fill this knowledge gap, field sampling was conducted from January 2018 to December 2020, with a total of 60 randomly selected sampling sites (540 plots) along the elevation gradient to collect vegetation and environmental data. Multivariate statistical tools were employed to analyse the data. The results depicted that the study area has 382 plant species which belong to five significantly different (p < 0.05) plant associations, each having unique species composition. Canonical correspondence analysis (CCA) results depicted that elevation, annual precipitation, latitude value, available potassium, normalised difference vegetation index (NDVI), and longitude value (in order) were the most influential drivers (p < 0.05) of the vegetation differences. Anthropogenic disturbances like deforestation and grazing pressure were recorded as important factors as well. Shannon's diversity mapping suggests that the central parts of the study area, including the Rangla, Thub, Mallot, Banni Passari, and Jaglari areas, as well as the Lasdana area in the east, were the most diverse (H' > 3) and are key hotspot candidates for conserving local diversity and improving management in the region. This study recorded some non-native plant species, including Sisyrinchium micranthum and Mazus caducifer, for the first time in Pakistan. These invasive species were found to be successfully naturalising; therefore, continuous monitoring of their competitive abilities compared to native flora is necessary.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Pakistan
*Biodiversity
*Environmental Monitoring
*Plants/classification
Conservation of Natural Resources
Forests
Ecosystem
Himalayas
RevDate: 2026-03-04
CmpDate: 2026-03-04
Better together: Microbial diversity might facilitate the invasion success of the seagrass Halophila stipulacea in mixed Mediterranean seagrass communities.
bioRxiv : the preprint server for biology.
Microorganisms are increasingly recognized as key facilitators of invasion success for introduced species into new environments. The globally invasive seagrass Halophila stipulacea flourishes in mixed environments with native seagrasses, where it exhibits enhanced growth, while, in contrast, native seagrasses in mixed environments experience reduced growth. Here, we hypothesize that microbes may support the success of invasive seagrass in mixed Mediterranean environments. We analyzed 16S rRNA genes to characterize the microbial diversity on the phyllosphere alongside biochemical, morphological, and sediment nutrient measurements of the Mediterranean-native seagrass Cymodocea nodosa and the invasive H. stipulacea from a controlled mesocosm experiment. Overall, C. nodosa in monoculture harbored a microbiome exhibiting higher ASV richness and a distinct community composition than H. stipulacea. Variation in bacterial diversity associated with hydrogen peroxide (H2O2) and internode length suggests that microbial communities of the native seagrass might be shaped by its stress. Conversely, H. stipulacea's microbiome was most abundant in mixed environments, with bacteria significantly reduced in monoculture, and bacterial diversity loosely associated with growth, suggesting that microbes are critical to assisting and possibly facilitating H. stipulacea in mixed environments. Overall, our findings suggest that invasive H. stipulacea in the Mediterranean Sea are capable of recruiting beneficial bacteria, creating microbial interactions that support its success, and undermining the resilience of native seagrasses in mixed beds. Future work should center on the mechanisms driving H. stipulacea bacterial communities and investigating whether H. stipulacea actively determines its own microbiome, or whether its microbiome is passively determined by environmental variables.
Additional Links: PMID-41727154
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41727154,
year = {2026},
author = {Hoza-Frederick, E and Martínez-Campos, S and Barber, PH and Vasquez, MI and Fotopoulos, V and Antoniou, C and Drakou, K and Godoy-Vitorino, F and Chiquillo, KL},
title = {Better together: Microbial diversity might facilitate the invasion success of the seagrass Halophila stipulacea in mixed Mediterranean seagrass communities.},
journal = {bioRxiv : the preprint server for biology},
volume = {},
number = {},
pages = {},
pmid = {41727154},
issn = {2692-8205},
abstract = {Microorganisms are increasingly recognized as key facilitators of invasion success for introduced species into new environments. The globally invasive seagrass Halophila stipulacea flourishes in mixed environments with native seagrasses, where it exhibits enhanced growth, while, in contrast, native seagrasses in mixed environments experience reduced growth. Here, we hypothesize that microbes may support the success of invasive seagrass in mixed Mediterranean environments. We analyzed 16S rRNA genes to characterize the microbial diversity on the phyllosphere alongside biochemical, morphological, and sediment nutrient measurements of the Mediterranean-native seagrass Cymodocea nodosa and the invasive H. stipulacea from a controlled mesocosm experiment. Overall, C. nodosa in monoculture harbored a microbiome exhibiting higher ASV richness and a distinct community composition than H. stipulacea. Variation in bacterial diversity associated with hydrogen peroxide (H2O2) and internode length suggests that microbial communities of the native seagrass might be shaped by its stress. Conversely, H. stipulacea's microbiome was most abundant in mixed environments, with bacteria significantly reduced in monoculture, and bacterial diversity loosely associated with growth, suggesting that microbes are critical to assisting and possibly facilitating H. stipulacea in mixed environments. Overall, our findings suggest that invasive H. stipulacea in the Mediterranean Sea are capable of recruiting beneficial bacteria, creating microbial interactions that support its success, and undermining the resilience of native seagrasses in mixed beds. Future work should center on the mechanisms driving H. stipulacea bacterial communities and investigating whether H. stipulacea actively determines its own microbiome, or whether its microbiome is passively determined by environmental variables.},
}
RevDate: 2026-02-23
CmpDate: 2026-02-23
Co-invasion of three invasive alien plants increases plant taxonomic diversity and community invasibility.
Plant diversity, 48(1):204-211.
Alien species from the Asteraceae family frequently invade native plant communities. This study aims to determine how the number of Asteraceae species (i.e., Erigeron canadensis, E. annuus, and Solidago canadensis) in a co-invasion affects plant taxonomic diversity and invasibility in plant communities in China. We found that co-invasions by one or two Asteraceae species decreased plant diversity and increased community invasibility. However, co-invasion by three Asteraceae species increased plant diversity and community invasibility. We also found that plant taxonomic diversity was negatively correlated with total coverage of invasive Asteraceae species. Conversely, community invasibility was positively correlated with total coverage of invasive Asteraceae species. These findings indicate that the number of Asteraceae invasive species positively correlates with total coverage, diversity, dominance, evenness, and invasibility. Our study shows that co-invasion by three IAS may increase plant taxonomic diversity but also community invasibility, which may further facilitate subsequent invasion.
Additional Links: PMID-41726809
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41726809,
year = {2026},
author = {Liu, Y and Du, Y and Li, C and Li, Y and Wang, C and Du, D},
title = {Co-invasion of three invasive alien plants increases plant taxonomic diversity and community invasibility.},
journal = {Plant diversity},
volume = {48},
number = {1},
pages = {204-211},
pmid = {41726809},
issn = {2468-2659},
abstract = {Alien species from the Asteraceae family frequently invade native plant communities. This study aims to determine how the number of Asteraceae species (i.e., Erigeron canadensis, E. annuus, and Solidago canadensis) in a co-invasion affects plant taxonomic diversity and invasibility in plant communities in China. We found that co-invasions by one or two Asteraceae species decreased plant diversity and increased community invasibility. However, co-invasion by three Asteraceae species increased plant diversity and community invasibility. We also found that plant taxonomic diversity was negatively correlated with total coverage of invasive Asteraceae species. Conversely, community invasibility was positively correlated with total coverage of invasive Asteraceae species. These findings indicate that the number of Asteraceae invasive species positively correlates with total coverage, diversity, dominance, evenness, and invasibility. Our study shows that co-invasion by three IAS may increase plant taxonomic diversity but also community invasibility, which may further facilitate subsequent invasion.},
}
RevDate: 2026-02-23
CmpDate: 2026-02-23
Unraveling the invasion patterns of Galinsoga quadriradiata in mountain ranges: Insights from human activities, phenotypic and genetic variations.
Plant diversity, 48(1):192-203.
Prevention of biological invasion requires understanding how alien species invade native communities. Although studies have identified mechanisms that underlie plant invasion in some habitats, limited attention has focused on invasion patterns along elevational gradients. In this study, we asked which factors drive the global and regional distribution of the invasive plant Galinsoga quadriradiata along elevational gradients. To answer this question, we examined whether human activities (i.e., roads) promote G. quadriradiata invasion, how seed dispersal-related traits of G. quadriradiata change along elevation gradients, and whether G. quadriradiata has adapted to high-elevation environments through phenotypic plasticity or genetic variation. On the global scale, we found that human activities and road density positively contribute to the G. quadriradiata expansion in mountainous areas. Field surveys in China revealed significant elevational differences in the seed dispersal traits of G. quadriradiata, with higher-elevation populations exhibiting lower dispersal ability and generally lower genetic diversity. Under common conditions, high-elevation populations showed higher leaf mass ratio but lower root mass ratio and reproductive allocation. This suggests that high-elevation environments create a barrier to dispersal for G. quadriradiata, and that G. quadriradiata has adapted phenotypically to these conditions. Our study indicates that the elevational invasion pattern of G. quadriradiata is shaped by multiple factors, particularly human activities and phenotypic adaptability. In addition, our finding that G. quadriradiata invasion at high elevations is not constrained by low genetic diversity indicates that monitoring and management of G. quadriradiata in mountainous areas should be strengthened.
Additional Links: PMID-41726802
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41726802,
year = {2026},
author = {Chen, Y and Song, X and Liu, G and Wang, J and Zhang, C and Chang, X and Zou, J and Zhu, Z},
title = {Unraveling the invasion patterns of Galinsoga quadriradiata in mountain ranges: Insights from human activities, phenotypic and genetic variations.},
journal = {Plant diversity},
volume = {48},
number = {1},
pages = {192-203},
pmid = {41726802},
issn = {2468-2659},
abstract = {Prevention of biological invasion requires understanding how alien species invade native communities. Although studies have identified mechanisms that underlie plant invasion in some habitats, limited attention has focused on invasion patterns along elevational gradients. In this study, we asked which factors drive the global and regional distribution of the invasive plant Galinsoga quadriradiata along elevational gradients. To answer this question, we examined whether human activities (i.e., roads) promote G. quadriradiata invasion, how seed dispersal-related traits of G. quadriradiata change along elevation gradients, and whether G. quadriradiata has adapted to high-elevation environments through phenotypic plasticity or genetic variation. On the global scale, we found that human activities and road density positively contribute to the G. quadriradiata expansion in mountainous areas. Field surveys in China revealed significant elevational differences in the seed dispersal traits of G. quadriradiata, with higher-elevation populations exhibiting lower dispersal ability and generally lower genetic diversity. Under common conditions, high-elevation populations showed higher leaf mass ratio but lower root mass ratio and reproductive allocation. This suggests that high-elevation environments create a barrier to dispersal for G. quadriradiata, and that G. quadriradiata has adapted phenotypically to these conditions. Our study indicates that the elevational invasion pattern of G. quadriradiata is shaped by multiple factors, particularly human activities and phenotypic adaptability. In addition, our finding that G. quadriradiata invasion at high elevations is not constrained by low genetic diversity indicates that monitoring and management of G. quadriradiata in mountainous areas should be strengthened.},
}
RevDate: 2026-02-24
Back to the river: Behavioural patterns of Eurasian beavers recolonising central Italy.
Behavioural processes, 237:105363 pii:S0376-6357(26)00037-9 [Epub ahead of print].
Newly introduced species may alter the structure and functioning of colonised ecosystems, particularly when they act as ecosystem engineers. The Eurasian beaver Castor fiber, historically present in central Italy until the Middle Ages, has recently reappeared in the region. Despite growing evidence of its ecological impacts, detailed information on its behavioural repertoire in Mediterranean environments is lacking. Here, the first comprehensive behavioural assessment of Eurasian beavers recolonising central Italy using intensive camera trapping across three river systems is provided. From March 2023 to May 2024, 24 distinct behavioural patterns were recorded and their occurrence and duration were quantified across age classes, sex, and seasons. Behavioural expression was strongly age-dependent: juveniles showed significantly higher levels of play, allogrooming, nose-touching, and exploratory behaviour, while subadults exhibited increased diving and exploration, indicating a transition towards independence. Adults displayed a broader and more functional repertoire, with higher frequencies of swimming, vigilance, scent marking, and material transport on land, reflecting their role in territory maintenance and construction activities. Seasonality also shaped behaviour markedly. Dam-building and digging activities and swimming were significantly more frequent during the cold period, whereas self-grooming sharply increased during warm period, suggesting thermally-driven behavioural plasticity. Model comparisons revealed that social and developmental behaviours were best explained by age, whereas construction and maintenance behaviours were primarily driven by seasonal conditions. Compared with northern European populations, Italian beavers showed lower building frequencies but increased terrestrial and swimming activities, suggesting context-dependent behavioural adjustments shaped by local ecological conditions.
Additional Links: PMID-41724453
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41724453,
year = {2026},
author = {Viviano, A and Ancillotto, L and Dondina, O and Palagi, E and Lelli, N and Mori, E},
title = {Back to the river: Behavioural patterns of Eurasian beavers recolonising central Italy.},
journal = {Behavioural processes},
volume = {237},
number = {},
pages = {105363},
doi = {10.1016/j.beproc.2026.105363},
pmid = {41724453},
issn = {1872-8308},
abstract = {Newly introduced species may alter the structure and functioning of colonised ecosystems, particularly when they act as ecosystem engineers. The Eurasian beaver Castor fiber, historically present in central Italy until the Middle Ages, has recently reappeared in the region. Despite growing evidence of its ecological impacts, detailed information on its behavioural repertoire in Mediterranean environments is lacking. Here, the first comprehensive behavioural assessment of Eurasian beavers recolonising central Italy using intensive camera trapping across three river systems is provided. From March 2023 to May 2024, 24 distinct behavioural patterns were recorded and their occurrence and duration were quantified across age classes, sex, and seasons. Behavioural expression was strongly age-dependent: juveniles showed significantly higher levels of play, allogrooming, nose-touching, and exploratory behaviour, while subadults exhibited increased diving and exploration, indicating a transition towards independence. Adults displayed a broader and more functional repertoire, with higher frequencies of swimming, vigilance, scent marking, and material transport on land, reflecting their role in territory maintenance and construction activities. Seasonality also shaped behaviour markedly. Dam-building and digging activities and swimming were significantly more frequent during the cold period, whereas self-grooming sharply increased during warm period, suggesting thermally-driven behavioural plasticity. Model comparisons revealed that social and developmental behaviours were best explained by age, whereas construction and maintenance behaviours were primarily driven by seasonal conditions. Compared with northern European populations, Italian beavers showed lower building frequencies but increased terrestrial and swimming activities, suggesting context-dependent behavioural adjustments shaped by local ecological conditions.},
}
RevDate: 2026-02-22
Thermal niches and climate change reshape marine invasion risk worldwide.
Marine environmental research, 217:107919 pii:S0141-1136(26)00088-7 [Epub ahead of print].
Marine biological invasions and climate change are two major drivers of biodiversity loss, yet their interactions remain poorly understood. Here, we used correlative ecological niche models (ENMs) to characterise the thermal niches of 80 globally invasive marine species and project their thermal suitability from 2020 to 2100 under multiple Shared Socioeconomic Pathway scenarios. Our models, based on Minimum Volume Ellipsoids fitted to sea surface and bottom temperatures, revealed substantial differences across species' thermal affinities. Tropical and subtropical invaders are projected to experience widespread declines in thermal suitability, suggesting that warming at low latitudes may approach their physiological thermal limits and redistribute thermally suitable conditions toward higher latitudes (25° to 35° N/S). Temperate species exhibited lower magnitudes of thermal suitability change, consistent with their broader thermal tolerances, although increases in thermal suitability at higher latitudes (50° to 60° N/S) suggest potential emerging invasion risks as polar barriers weaken. Climate change is expected to reshape marine invasion patterns by altering the spatial distribution of thermally suitable conditions, amplifying risks at mid-to-high latitudes while constraining some tropical invaders. While our findings provide a baseline for understanding thermal constraints on marine bioinvasions, caution is warranted: realised niches may underestimate species' full thermal tolerances, and key factors like biotic interactions, functional characteristics, and other environmental variables were not included. Nonetheless, thermal niches emerge as a strong predictor of potential invasion risk, identifying regions with high thermal suitability for invasive species and informing early detection and management strategies.
Additional Links: PMID-41724065
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41724065,
year = {2026},
author = {Angeles-Gonzalez, LE and Villalobos-Guerrero, TF and Delgadillo-Nuño, MA and Torrejón-Magallanes, J and Escamilla-Aké, A and Díaz, F and Rosas, C},
title = {Thermal niches and climate change reshape marine invasion risk worldwide.},
journal = {Marine environmental research},
volume = {217},
number = {},
pages = {107919},
doi = {10.1016/j.marenvres.2026.107919},
pmid = {41724065},
issn = {1879-0291},
abstract = {Marine biological invasions and climate change are two major drivers of biodiversity loss, yet their interactions remain poorly understood. Here, we used correlative ecological niche models (ENMs) to characterise the thermal niches of 80 globally invasive marine species and project their thermal suitability from 2020 to 2100 under multiple Shared Socioeconomic Pathway scenarios. Our models, based on Minimum Volume Ellipsoids fitted to sea surface and bottom temperatures, revealed substantial differences across species' thermal affinities. Tropical and subtropical invaders are projected to experience widespread declines in thermal suitability, suggesting that warming at low latitudes may approach their physiological thermal limits and redistribute thermally suitable conditions toward higher latitudes (25° to 35° N/S). Temperate species exhibited lower magnitudes of thermal suitability change, consistent with their broader thermal tolerances, although increases in thermal suitability at higher latitudes (50° to 60° N/S) suggest potential emerging invasion risks as polar barriers weaken. Climate change is expected to reshape marine invasion patterns by altering the spatial distribution of thermally suitable conditions, amplifying risks at mid-to-high latitudes while constraining some tropical invaders. While our findings provide a baseline for understanding thermal constraints on marine bioinvasions, caution is warranted: realised niches may underestimate species' full thermal tolerances, and key factors like biotic interactions, functional characteristics, and other environmental variables were not included. Nonetheless, thermal niches emerge as a strong predictor of potential invasion risk, identifying regions with high thermal suitability for invasive species and informing early detection and management strategies.},
}
RevDate: 2026-02-23
CmpDate: 2026-02-21
Environmental filtering drives patterns of ant species richness and activity across Hawaiian coffee farms.
Journal of insect science (Online), 26(1):.
Ants perform diverse ecological functions in agricultural systems, yet in Hawai'i, all established ant species are thought to be introduced, creating novel communities shaped by environmental conditions. We examined how coffee-growing district and microclimate structure invasive ant communities in Hawaiian coffee agroecosystems. Ants were surveyed across 15 coffee farms on Hawai'i Island spanning a 600-m elevational gradient and 2 growing districts (Kona and Ka'ū). We quantified ant species richness, activity, and tree-level occupancy and evaluated associations with district, elevation, rainfall, temperature, and humidity. We recorded 22 ant species across 3 subfamilies, with Brachymyrmex obscurior, Ochetellus glaber, Pheidole megacephala, Plagiolepis alluaudi, and Tapinoma melanocephalum being the most common species. Ant species richness, activity, and tree-level occupancy were significantly higher in Kona compared to Ka'ū and declined with increasing annual rainfall. Activity of several common species was positively associated with overall species richness, while no common species showed a strong negative association with richness. These results suggest that environmental filtering, rather than competitive dominance, structures invasive ant communities in Hawaiian coffee systems. Our findings indicate that invasive ants are most active and widespread in warmer, drier coffee farms, where they may exert their strongest ecological effects. These results provide baseline information for understanding the distribution of ants in Hawaiian coffee agroecosystems and establish a foundation for future research evaluating ant-mediated pest suppression, mutualisms, and other ecosystem services and disservices in coffee production.
Additional Links: PMID-41722027
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41722027,
year = {2026},
author = {Cowal, S and Mueller, M and Johnson, MA},
title = {Environmental filtering drives patterns of ant species richness and activity across Hawaiian coffee farms.},
journal = {Journal of insect science (Online)},
volume = {26},
number = {1},
pages = {},
pmid = {41722027},
issn = {1536-2442},
support = {2040-22430-027-027S//USDA-ARS Area-wide/ ; },
mesh = {Animals ; *Ants/physiology ; Hawaii ; *Biodiversity ; Coffea/growth & development ; *Introduced Species ; Coffee ; Agriculture ; },
abstract = {Ants perform diverse ecological functions in agricultural systems, yet in Hawai'i, all established ant species are thought to be introduced, creating novel communities shaped by environmental conditions. We examined how coffee-growing district and microclimate structure invasive ant communities in Hawaiian coffee agroecosystems. Ants were surveyed across 15 coffee farms on Hawai'i Island spanning a 600-m elevational gradient and 2 growing districts (Kona and Ka'ū). We quantified ant species richness, activity, and tree-level occupancy and evaluated associations with district, elevation, rainfall, temperature, and humidity. We recorded 22 ant species across 3 subfamilies, with Brachymyrmex obscurior, Ochetellus glaber, Pheidole megacephala, Plagiolepis alluaudi, and Tapinoma melanocephalum being the most common species. Ant species richness, activity, and tree-level occupancy were significantly higher in Kona compared to Ka'ū and declined with increasing annual rainfall. Activity of several common species was positively associated with overall species richness, while no common species showed a strong negative association with richness. These results suggest that environmental filtering, rather than competitive dominance, structures invasive ant communities in Hawaiian coffee systems. Our findings indicate that invasive ants are most active and widespread in warmer, drier coffee farms, where they may exert their strongest ecological effects. These results provide baseline information for understanding the distribution of ants in Hawaiian coffee agroecosystems and establish a foundation for future research evaluating ant-mediated pest suppression, mutualisms, and other ecosystem services and disservices in coffee production.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Ants/physiology
Hawaii
*Biodiversity
Coffea/growth & development
*Introduced Species
Coffee
Agriculture
RevDate: 2026-02-21
CmpDate: 2026-02-21
Methods for estimating status and change in presence and foliar cover area of invasive plants using national forest inventory data.
Environmental monitoring and assessment, 198(3):.
The influence of invasive plant species (IPS) on forest ecosystems has been of sufficient concern to warrant data acquisition on their presence and abundance. These data are needed at various spatial scales for both land management and policy purposes. One potential source of data are national forest inventories (NFIs) that often record IPS observations on sample plots that span relatively large spatial and temporal extents, thus providing data users with a wide range of analytical opportunities to meet desired information needs. In the NFI of the USA, which is conducted by the USA Forest Service's Forest Inventory and Analysis (FIA) program, IPS presence and foliar cover area are visually observed and recorded nationally on a spatially balanced subset of inventory plots measured each year. As with any sample-based assessment, the implementation of statistically appropriate methods is imperative for credibility of the final estimates. In this paper, statistical methods for calculating population estimates and associated measures of uncertainty for current status and change in IPS attributes are presented. The estimators address both presence and cover area estimation, as well as estimation of area proportions relative to total area domains. Also included are data and various numeric examples that assist in understanding the estimation steps and provide for verification of accuracy in results. The methods should be applicable to most IPS data collected in other forest inventories with little or no modification.
Additional Links: PMID-41721903
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41721903,
year = {2026},
author = {Westfall, JA and Lister, AJ and Pugh, SA and Lister, TW and Kurtz, CM},
title = {Methods for estimating status and change in presence and foliar cover area of invasive plants using national forest inventory data.},
journal = {Environmental monitoring and assessment},
volume = {198},
number = {3},
pages = {},
pmid = {41721903},
issn = {1573-2959},
mesh = {*Forests ; *Introduced Species/statistics & numerical data ; *Environmental Monitoring/methods ; United States ; Conservation of Natural Resources/methods ; *Trees/growth & development ; *Plants ; Ecosystem ; },
abstract = {The influence of invasive plant species (IPS) on forest ecosystems has been of sufficient concern to warrant data acquisition on their presence and abundance. These data are needed at various spatial scales for both land management and policy purposes. One potential source of data are national forest inventories (NFIs) that often record IPS observations on sample plots that span relatively large spatial and temporal extents, thus providing data users with a wide range of analytical opportunities to meet desired information needs. In the NFI of the USA, which is conducted by the USA Forest Service's Forest Inventory and Analysis (FIA) program, IPS presence and foliar cover area are visually observed and recorded nationally on a spatially balanced subset of inventory plots measured each year. As with any sample-based assessment, the implementation of statistically appropriate methods is imperative for credibility of the final estimates. In this paper, statistical methods for calculating population estimates and associated measures of uncertainty for current status and change in IPS attributes are presented. The estimators address both presence and cover area estimation, as well as estimation of area proportions relative to total area domains. Also included are data and various numeric examples that assist in understanding the estimation steps and provide for verification of accuracy in results. The methods should be applicable to most IPS data collected in other forest inventories with little or no modification.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*Forests
*Introduced Species/statistics & numerical data
*Environmental Monitoring/methods
United States
Conservation of Natural Resources/methods
*Trees/growth & development
*Plants
Ecosystem
RevDate: 2026-02-23
Correction: Refined chloroplast annotations, repeat profiles, and phylogenomic evidence reveal maternal lineage shifts and independent evolution in the Triticum-Aegilops complex.
BMC plant biology, 26(1):.
Additional Links: PMID-41721261
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41721261,
year = {2026},
author = {Kadam, SK and Youn, JS and Kim, JH},
title = {Correction: Refined chloroplast annotations, repeat profiles, and phylogenomic evidence reveal maternal lineage shifts and independent evolution in the Triticum-Aegilops complex.},
journal = {BMC plant biology},
volume = {26},
number = {1},
pages = {},
pmid = {41721261},
issn = {1471-2229},
}
RevDate: 2026-02-26
Harnessing AMF-plant-microbe systems for heavy metal remediation.
Ecotoxicology and environmental safety, 311:119885.
Soil heavy metal pollution poses a global environmental threat, demanding effective and sustainable remediation strategies. Arbuscular mycorrhizal fungi (AMF) play a multifaceted role in enhancing the remediation of heavy metal (HM)-contaminated soils through extensive hyphal networks that interact with plant roots and soil microbiota. AMF hyphae and their exudates, such as glomalin, directly immobilize metal ions and reduce bioavailability by modifying soil properties (e.g., pH). Furthermore, AMF reshape the rhizosphere microbiome by enriching metal-tolerant bacteria (e.g., Pseudomonas, Bacillus) and fostering synergistic microbial communities via cross-kingdom signaling. Within plants, AMF symbiosis-especially with hyperaccumulators-optimizes root architecture, enhances nutrient and water uptake, stimulates biomass production, and regulates key physiological and molecular responses. These include bolstering antioxidant defenses, maintaining photosynthetic efficiency, and upregulating genes involved in metal transport, compartmentalization, and stress signaling. Field studies confirm the potential of AMF-hyperaccumulator systems in metal extraction and stabilization. However, transitioning from controlled experiments to field applications remains challenging due to the complexity of multipartite interactions and a lack of predictive frameworks. This review critically integrates interdisciplinary insights into a forward-looking perspective, emphasizing the need to shift from empirical approaches to an intelligent, predictive design paradigm. We propose leveraging machine learning to decode interactions among AMF genotypes, plant phenotypes, microbial consortia, and soil properties, enabling the rational design of efficient remediation systems. Ultimately, overcoming barriers to field implementation requires integrating robust science with advanced engineering and supportive policy frameworks.
Additional Links: PMID-41719980
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41719980,
year = {2026},
author = {Xu, Y and Ke, J and Zhang, Y and Chen, X and Wang, Y},
title = {Harnessing AMF-plant-microbe systems for heavy metal remediation.},
journal = {Ecotoxicology and environmental safety},
volume = {311},
number = {},
pages = {119885},
doi = {10.1016/j.ecoenv.2026.119885},
pmid = {41719980},
issn = {1090-2414},
abstract = {Soil heavy metal pollution poses a global environmental threat, demanding effective and sustainable remediation strategies. Arbuscular mycorrhizal fungi (AMF) play a multifaceted role in enhancing the remediation of heavy metal (HM)-contaminated soils through extensive hyphal networks that interact with plant roots and soil microbiota. AMF hyphae and their exudates, such as glomalin, directly immobilize metal ions and reduce bioavailability by modifying soil properties (e.g., pH). Furthermore, AMF reshape the rhizosphere microbiome by enriching metal-tolerant bacteria (e.g., Pseudomonas, Bacillus) and fostering synergistic microbial communities via cross-kingdom signaling. Within plants, AMF symbiosis-especially with hyperaccumulators-optimizes root architecture, enhances nutrient and water uptake, stimulates biomass production, and regulates key physiological and molecular responses. These include bolstering antioxidant defenses, maintaining photosynthetic efficiency, and upregulating genes involved in metal transport, compartmentalization, and stress signaling. Field studies confirm the potential of AMF-hyperaccumulator systems in metal extraction and stabilization. However, transitioning from controlled experiments to field applications remains challenging due to the complexity of multipartite interactions and a lack of predictive frameworks. This review critically integrates interdisciplinary insights into a forward-looking perspective, emphasizing the need to shift from empirical approaches to an intelligent, predictive design paradigm. We propose leveraging machine learning to decode interactions among AMF genotypes, plant phenotypes, microbial consortia, and soil properties, enabling the rational design of efficient remediation systems. Ultimately, overcoming barriers to field implementation requires integrating robust science with advanced engineering and supportive policy frameworks.},
}
RevDate: 2026-02-20
CmpDate: 2026-02-20
Fertility Control in Wildlife: Review of Current Status, Including Novel and Future Technologies.
Advances in experimental medicine and biology, 16:605-645.
Wildlife conservation requires varying degrees of management of endangered species as well as management of their potential predators and competitors. Conservation also depends on ameliorating human-wildlife conflict, especially where there is a threat to the safety of people and of their pets and livestock. In addition, sustainability of wildlife populations can be affected by feral domestic animals or invasive species that require removal or control. With the increasing concern for animal welfare, non-lethal methods of limiting population size and distribution, such as fertility control, are gaining favor. Breeding programs in zoos depend on highly effective and selective contraception to manage sustainable insurance populations. This review covers fertility control methods currently in use, those that have not lived up to past promises, and others that are under development and present hope for addressing remaining challenges.
Additional Links: PMID-41718883
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41718883,
year = {2026},
author = {Asa, CS and Moresco, A},
title = {Fertility Control in Wildlife: Review of Current Status, Including Novel and Future Technologies.},
journal = {Advances in experimental medicine and biology},
volume = {16},
number = {},
pages = {605-645},
pmid = {41718883},
issn = {0065-2598},
mesh = {Animals ; *Animals, Wild/physiology ; *Fertility/physiology ; *Conservation of Natural Resources/methods ; Endangered Species ; Female ; *Contraception/methods/veterinary ; Humans ; },
abstract = {Wildlife conservation requires varying degrees of management of endangered species as well as management of their potential predators and competitors. Conservation also depends on ameliorating human-wildlife conflict, especially where there is a threat to the safety of people and of their pets and livestock. In addition, sustainability of wildlife populations can be affected by feral domestic animals or invasive species that require removal or control. With the increasing concern for animal welfare, non-lethal methods of limiting population size and distribution, such as fertility control, are gaining favor. Breeding programs in zoos depend on highly effective and selective contraception to manage sustainable insurance populations. This review covers fertility control methods currently in use, those that have not lived up to past promises, and others that are under development and present hope for addressing remaining challenges.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Animals, Wild/physiology
*Fertility/physiology
*Conservation of Natural Resources/methods
Endangered Species
Female
*Contraception/methods/veterinary
Humans
RevDate: 2026-02-20
CmpDate: 2026-02-20
Conservation of Teleost Fishes: Current Status and the Role of Reproductive Technologies.
Advances in experimental medicine and biology, 16:369-405.
Fishes are by far the most species-rich group of vertebrates, with 36,105 species currently recognized, approximately the same number of species as that of all non-fish vertebrates combined. Recent decades have witnessed dramatic population declines for many fish species, together with a loss in overall fish biodiversity. Globally, fish biodiversity is being threatened by a multitude of anthropogenic impacts including overfishing, habitat loss, pollution, aquaculture, loss of river connectivity, climate change and the impact of alien species. Nowhere is the world's biodiversity crisis more acute than in freshwater ecosystems. While rivers, lakes and wetlands cover less than 1% of the planet's total surface, they are home to over half the world´s fish species. One-third of freshwater fishes are now threatened with extinction, and 80 species have become extinct in recent years. This review covers the main drivers of declining fish biodiversity and details remedial strategies aimed at conserving both marine and freshwater fish biodiversity. The preservation of genetic resources through the cryobanking of reproductive cells and tissues, collectively known as germplasm, will increasingly become a valuable tool in the conservation of fish biodiversity. It is expected that the ability to establish cryobanks for the full range of fish germplasm, including sperm, oocytes, embryos and germ cells will be of key importance to the conservation of threatened fish species, as well as to fishery management and aquaculture. With the help of a range of emerging reproductive technologies, frozen germplasm will play a key role in future in situ and ex situ conservation initiatives. The rapid advance in next-generation sequencing technologies, together with the proliferation of resources such as fully sequenced fish genomes, is expected to result in a rapid expansion in the application of conservation genomics to the field of fish conservation and be instrumental in formulating future management strategies directed at conserving fish biodiversity, through both in situ and ex situ conservation initiatives.
Additional Links: PMID-41718877
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41718877,
year = {2026},
author = {Mayer, I},
title = {Conservation of Teleost Fishes: Current Status and the Role of Reproductive Technologies.},
journal = {Advances in experimental medicine and biology},
volume = {16},
number = {},
pages = {369-405},
pmid = {41718877},
issn = {0065-2598},
mesh = {Animals ; *Fishes/physiology/genetics ; *Conservation of Natural Resources/methods ; Biodiversity ; Endangered Species ; Cryopreservation ; },
abstract = {Fishes are by far the most species-rich group of vertebrates, with 36,105 species currently recognized, approximately the same number of species as that of all non-fish vertebrates combined. Recent decades have witnessed dramatic population declines for many fish species, together with a loss in overall fish biodiversity. Globally, fish biodiversity is being threatened by a multitude of anthropogenic impacts including overfishing, habitat loss, pollution, aquaculture, loss of river connectivity, climate change and the impact of alien species. Nowhere is the world's biodiversity crisis more acute than in freshwater ecosystems. While rivers, lakes and wetlands cover less than 1% of the planet's total surface, they are home to over half the world´s fish species. One-third of freshwater fishes are now threatened with extinction, and 80 species have become extinct in recent years. This review covers the main drivers of declining fish biodiversity and details remedial strategies aimed at conserving both marine and freshwater fish biodiversity. The preservation of genetic resources through the cryobanking of reproductive cells and tissues, collectively known as germplasm, will increasingly become a valuable tool in the conservation of fish biodiversity. It is expected that the ability to establish cryobanks for the full range of fish germplasm, including sperm, oocytes, embryos and germ cells will be of key importance to the conservation of threatened fish species, as well as to fishery management and aquaculture. With the help of a range of emerging reproductive technologies, frozen germplasm will play a key role in future in situ and ex situ conservation initiatives. The rapid advance in next-generation sequencing technologies, together with the proliferation of resources such as fully sequenced fish genomes, is expected to result in a rapid expansion in the application of conservation genomics to the field of fish conservation and be instrumental in formulating future management strategies directed at conserving fish biodiversity, through both in situ and ex situ conservation initiatives.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Fishes/physiology/genetics
*Conservation of Natural Resources/methods
Biodiversity
Endangered Species
Cryopreservation
RevDate: 2026-02-20
CmpDate: 2026-02-20
Landscape Genomics and Evolutionary History of Megamelus scutellaris, a Biocontrol Agent of the Invasive Water Hyacinth (Pontederia crassipes).
Evolutionary applications, 19(2):e70208.
Understanding the evolutionary history of biological control agents in their native ranges is crucial for improving their selection, establishment, and performance across environmentally diverse regions. Phytophagous insects that specialize on aquatic plants offer particularly valuable models, as their evolutionary trajectories may be shaped by a combination of climatic variation, host plant availability, and the fragmented nature of aquatic habitats. Megamelus scutellaris is a monophagous planthopper native to South America that has been introduced into the United States and South Africa as part of biological control programs targeting the highly invasive aquatic plant, Pontederia crassipes. In this work, we combined nuclear SNP and mitochondrial sequence data to investigate the genetic structure, demographic history, and environmental drivers of population divergence in M. scutellaris across its native range in Argentina and Paraguay. We identified three main genetic lineages broadly associated with major river basins and ecoregions. Demographic modeling supported an early divergence, likely linked to Pleistocene climatic shifts and hydrological changes, followed by a more recent split dated to the early Holocene. Contemporary gene flow was asymmetric and varied in magnitude among lineages, reflecting differences in connectivity and environmental conditions. Lastly, landscape genomic analyzes revealed a strong association between genetic differentiation and climatic variation, supporting models of isolation by environment and resistance. These findings highlight the role of evolutionary and ecological processes in shaping the genetic landscape of M. scutellaris and provide key insights for selecting source populations better suited to different environments in introduced regions.
Additional Links: PMID-41717537
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41717537,
year = {2026},
author = {Salinas, NA and Poveda-Martínez, D and Rodriguero, MS and Smith, MC and Brentassi, ME and Sosa, AJ},
title = {Landscape Genomics and Evolutionary History of Megamelus scutellaris, a Biocontrol Agent of the Invasive Water Hyacinth (Pontederia crassipes).},
journal = {Evolutionary applications},
volume = {19},
number = {2},
pages = {e70208},
pmid = {41717537},
issn = {1752-4571},
abstract = {Understanding the evolutionary history of biological control agents in their native ranges is crucial for improving their selection, establishment, and performance across environmentally diverse regions. Phytophagous insects that specialize on aquatic plants offer particularly valuable models, as their evolutionary trajectories may be shaped by a combination of climatic variation, host plant availability, and the fragmented nature of aquatic habitats. Megamelus scutellaris is a monophagous planthopper native to South America that has been introduced into the United States and South Africa as part of biological control programs targeting the highly invasive aquatic plant, Pontederia crassipes. In this work, we combined nuclear SNP and mitochondrial sequence data to investigate the genetic structure, demographic history, and environmental drivers of population divergence in M. scutellaris across its native range in Argentina and Paraguay. We identified three main genetic lineages broadly associated with major river basins and ecoregions. Demographic modeling supported an early divergence, likely linked to Pleistocene climatic shifts and hydrological changes, followed by a more recent split dated to the early Holocene. Contemporary gene flow was asymmetric and varied in magnitude among lineages, reflecting differences in connectivity and environmental conditions. Lastly, landscape genomic analyzes revealed a strong association between genetic differentiation and climatic variation, supporting models of isolation by environment and resistance. These findings highlight the role of evolutionary and ecological processes in shaping the genetic landscape of M. scutellaris and provide key insights for selecting source populations better suited to different environments in introduced regions.},
}
RevDate: 2026-02-20
CmpDate: 2026-02-20
Species Occurrence and Seasonal Variation of Malaria Vectors in Hadiya Zone, Ethiopia.
BioMed research international, 2026:4553611.
Environmental change can alter the species occurrence and seasonal distribution of malaria vectors to higher altitudes and latitudes. Highlands remain dynamic due to factors that favor their growth and development. Invasive species have proliferated into new ecological niches, increased. These studies aimed to determine the species occurrence and seasonal variation of malaria vectors in the selected study area. Entomological surveys were conducted in different types of larval habitats from October 2023 up to June 2024 within four purposively selected study villages. The species were morphologically identified using a stereomicroscope, and then data was analyzed using R version 4.3.1 (2023-06-16 ucrt) statistical analysis software. A total of 721 malaria vector larvae were collected, representing Anopheles gambiae s.l., An. funestus s.l., An. coustani, and An. pharoensis. An. gambiae s.l. was the dominant species, accounting for 43.82% (n = 316) of all collections, while An. pharoensis was the least abundant (7.9%, n = 57). Spatial variation was observed, with Shemo Boyo recording the highest number of larvae (45.50%, n = 328), whereas Kemecho Borara had the lowest (9.57%, n = 69). Among the habitat types, ditches had the highest mean larval density (2.61 larvae per sample), followed by swamps (1.5) and riverbeds (0.8), whereas water pans had the lowest density (0.14). Overall mean larval density was 1.11 larvae per sample, and larval abundance significantly differed across habitat categories (f (3,647) = 4.005, p = 0.012). These findings indicate that An. gambiae s.l. is the predominant malaria vector in the area and likely plays a primary role in local transmission. Further studies on spatial mapping, physicochemical characterization, habitat preference, and isolation of malaria parasites are recommended to guide targeted larval source management and reduce the burden of mosquito-borne diseases.
Additional Links: PMID-41717316
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41717316,
year = {2026},
author = {Assemie, A and Mulu, D and Mekuriaw, E and Muluken, W},
title = {Species Occurrence and Seasonal Variation of Malaria Vectors in Hadiya Zone, Ethiopia.},
journal = {BioMed research international},
volume = {2026},
number = {},
pages = {4553611},
pmid = {41717316},
issn = {2314-6141},
mesh = {Animals ; Ethiopia/epidemiology ; *Seasons ; *Anopheles/parasitology/physiology ; *Malaria/transmission/epidemiology ; *Mosquito Vectors/parasitology ; Ecosystem ; Larva ; Humans ; },
abstract = {Environmental change can alter the species occurrence and seasonal distribution of malaria vectors to higher altitudes and latitudes. Highlands remain dynamic due to factors that favor their growth and development. Invasive species have proliferated into new ecological niches, increased. These studies aimed to determine the species occurrence and seasonal variation of malaria vectors in the selected study area. Entomological surveys were conducted in different types of larval habitats from October 2023 up to June 2024 within four purposively selected study villages. The species were morphologically identified using a stereomicroscope, and then data was analyzed using R version 4.3.1 (2023-06-16 ucrt) statistical analysis software. A total of 721 malaria vector larvae were collected, representing Anopheles gambiae s.l., An. funestus s.l., An. coustani, and An. pharoensis. An. gambiae s.l. was the dominant species, accounting for 43.82% (n = 316) of all collections, while An. pharoensis was the least abundant (7.9%, n = 57). Spatial variation was observed, with Shemo Boyo recording the highest number of larvae (45.50%, n = 328), whereas Kemecho Borara had the lowest (9.57%, n = 69). Among the habitat types, ditches had the highest mean larval density (2.61 larvae per sample), followed by swamps (1.5) and riverbeds (0.8), whereas water pans had the lowest density (0.14). Overall mean larval density was 1.11 larvae per sample, and larval abundance significantly differed across habitat categories (f (3,647) = 4.005, p = 0.012). These findings indicate that An. gambiae s.l. is the predominant malaria vector in the area and likely plays a primary role in local transmission. Further studies on spatial mapping, physicochemical characterization, habitat preference, and isolation of malaria parasites are recommended to guide targeted larval source management and reduce the burden of mosquito-borne diseases.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
Ethiopia/epidemiology
*Seasons
*Anopheles/parasitology/physiology
*Malaria/transmission/epidemiology
*Mosquito Vectors/parasitology
Ecosystem
Larva
Humans
RevDate: 2026-02-20
CmpDate: 2026-02-20
Comprehensive assessment of Erwinia amylovora: from establishment risk in global host production areas to dispersal dynamics and associated economic losses in China.
Frontiers in plant science, 16:1641129.
Erwinia amylovora is the bacterial pathogen that causes fire blight and is considered one of the most important plant pathogenic bacteria in the world, posing a serious threat to pear and apple production. However, majority of the current risk assessment studies have focused primarily on the potential geographic distribution of E. amylovora, with less focus on its dispersal patterns, dispersal risk areas, and economic impacts. Here, species distribution models, the minimum cost arborescence approach, the MigClim package, and Monte Carlo stochastic simulations were integrated to comprehensively assess the global establishment risk, the local dispersal patterns, the dispersal risk areas, and the economic losses for E. amylovora. The results showed that E. amylovora is primarily distributed in North America, southern South America, Europe, northern and southern Africa, western and eastern Asia, and southern Oceania under near-current climatic conditions. In addition, the overlapping area between the distribution area of E. amylovora and the host production area is 1,897.62 × 10[4] km[2], mainly located in central North America, southern South America, Europe, northern Africa, eastern and western Asia, and southern Oceania. Its global distribution and the overlapping areas are expected to expand further under future climatic conditions. Erwinia amylovora shows a primarily "leap-frog" long-distance spread in China, and the dispersal risk area is mainly in northwestern China. The economic losses caused by E. amylovora to the host industry amounted to 5,603.66 million dollars without any control measures; however, 2,390.13 million dollars can be saved after control measures. Such comprehensive risk assessments provide global guidance for the monitoring and control of E. amylovora in host production areas while also helping to formulate management priority strategies in local dispersal risk areas, thereby reducing economic impacts.
Additional Links: PMID-41716765
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41716765,
year = {2025},
author = {Li, M and Xian, X and Jin, Z and Qi, Y and Guo, J and Yang, N and Zhang, G and Xu, J and Liu, W},
title = {Comprehensive assessment of Erwinia amylovora: from establishment risk in global host production areas to dispersal dynamics and associated economic losses in China.},
journal = {Frontiers in plant science},
volume = {16},
number = {},
pages = {1641129},
pmid = {41716765},
issn = {1664-462X},
abstract = {Erwinia amylovora is the bacterial pathogen that causes fire blight and is considered one of the most important plant pathogenic bacteria in the world, posing a serious threat to pear and apple production. However, majority of the current risk assessment studies have focused primarily on the potential geographic distribution of E. amylovora, with less focus on its dispersal patterns, dispersal risk areas, and economic impacts. Here, species distribution models, the minimum cost arborescence approach, the MigClim package, and Monte Carlo stochastic simulations were integrated to comprehensively assess the global establishment risk, the local dispersal patterns, the dispersal risk areas, and the economic losses for E. amylovora. The results showed that E. amylovora is primarily distributed in North America, southern South America, Europe, northern and southern Africa, western and eastern Asia, and southern Oceania under near-current climatic conditions. In addition, the overlapping area between the distribution area of E. amylovora and the host production area is 1,897.62 × 10[4] km[2], mainly located in central North America, southern South America, Europe, northern Africa, eastern and western Asia, and southern Oceania. Its global distribution and the overlapping areas are expected to expand further under future climatic conditions. Erwinia amylovora shows a primarily "leap-frog" long-distance spread in China, and the dispersal risk area is mainly in northwestern China. The economic losses caused by E. amylovora to the host industry amounted to 5,603.66 million dollars without any control measures; however, 2,390.13 million dollars can be saved after control measures. Such comprehensive risk assessments provide global guidance for the monitoring and control of E. amylovora in host production areas while also helping to formulate management priority strategies in local dispersal risk areas, thereby reducing economic impacts.},
}
RevDate: 2026-02-20
CmpDate: 2026-02-20
Development of a Duplex Digital PCR and Validation on eDNA Water Samples for Monitoring of the Asian Swamp Eel (Monopterus albus/Javanensis) and Bullseye Snakehead (Channa aurolineata/Marulius) in Florida, USA, Freshwater Ecosystems.
Ecology and evolution, 16(2):e73088.
Invasive species are a significant threat to a variety of ecosystems in Florida, with freshwater habitats being of particular concern. Two nonnative species of fish with established populations that are priority organisms for monitoring and management programs are the bullseye snakehead (BS; Channa species complex) and Asian swamp eel (ASE; Monopterus species complex). Recent technological advances have seen the emergence of environmental DNA (eDNA) analysis as a useful tool for the detection and monitoring of target organisms and to assess removal efforts. In this study, a duplex digital polymerase chain reaction (dPCR) was developed, optimized, and validated on control samples and field samples from locations with documented occurrences of target organisms. The assay developed, which allows simultaneous detection of both fish species when present in a sample, demonstrated highly efficient amplification for the corresponding target species with individual assays failing to cross-amplify. Under controlled conditions, high levels of eDNA were detected as early as five minutes post-introduction of BS to water. Additionally, field eDNA samples yielded varying levels of positive amplification for both species based on comparison of fluorescence levels to positive controls (both tissue extract and plasmids with appropriate inserts). These data indicate that through careful assay design and stringent parameter optimization, eDNA results obtained for monitoring of these two fish species can be a viable and cost-effective strategy to detect the presence of these species simultaneously as well as to evaluate the success of removal efforts.
Additional Links: PMID-41716589
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41716589,
year = {2026},
author = {Bloch, M and Suarez, E and Miller, MA and Balaguera-Reina, SA and Fussell Persaud, CA and Olejniczak, KA and Helmick, EE and Mazzotti, FJ and Bahder, BW},
title = {Development of a Duplex Digital PCR and Validation on eDNA Water Samples for Monitoring of the Asian Swamp Eel (Monopterus albus/Javanensis) and Bullseye Snakehead (Channa aurolineata/Marulius) in Florida, USA, Freshwater Ecosystems.},
journal = {Ecology and evolution},
volume = {16},
number = {2},
pages = {e73088},
pmid = {41716589},
issn = {2045-7758},
abstract = {Invasive species are a significant threat to a variety of ecosystems in Florida, with freshwater habitats being of particular concern. Two nonnative species of fish with established populations that are priority organisms for monitoring and management programs are the bullseye snakehead (BS; Channa species complex) and Asian swamp eel (ASE; Monopterus species complex). Recent technological advances have seen the emergence of environmental DNA (eDNA) analysis as a useful tool for the detection and monitoring of target organisms and to assess removal efforts. In this study, a duplex digital polymerase chain reaction (dPCR) was developed, optimized, and validated on control samples and field samples from locations with documented occurrences of target organisms. The assay developed, which allows simultaneous detection of both fish species when present in a sample, demonstrated highly efficient amplification for the corresponding target species with individual assays failing to cross-amplify. Under controlled conditions, high levels of eDNA were detected as early as five minutes post-introduction of BS to water. Additionally, field eDNA samples yielded varying levels of positive amplification for both species based on comparison of fluorescence levels to positive controls (both tissue extract and plasmids with appropriate inserts). These data indicate that through careful assay design and stringent parameter optimization, eDNA results obtained for monitoring of these two fish species can be a viable and cost-effective strategy to detect the presence of these species simultaneously as well as to evaluate the success of removal efforts.},
}
RevDate: 2026-02-20
CmpDate: 2026-02-20
Controlled Experiments Reveal Moderate, Nonlinear Relationships Between eDNA Concentration and Fish Biomass in Three Freshwater Species of Monitoring Relevance.
Ecology and evolution, 16(2):e73129.
Understanding the relationship between environmental DNA (eDNA) concentration and taxa abundance is essential for the advancement of quantitative biodiversity monitoring. We experimentally manipulated biomass of three freshwater fish species of monitoring interest-the Italian-endemic Squalius lucumonis and the exotic-invasive Pseudorasbora parva and Lepomis gibbosus-under controlled conditions (flow-through 310 and 1330 L tanks). Following eDNA collection (2 L water filtration) and Real-Time PCR quantification, Generalized Additive Mixed Models (GAMMs) revealed: (i) monotonic non-linear relationships of moderate-to-high magnitude (0.42 < partial-R [2] < 0.62), with eDNA concentrations plateauing at intermediate biomasses in smaller-sized taxa; and (ii) a significant effect of experimental replicates (tanks) in two out of three species. These findings suggest that eDNA-based biomass quantification should not assume linearity, and emphasize the critical role of replication to account for inherent uncertainty, likely driven by inter- and intra-individual variations in eDNA shedding rates.
Additional Links: PMID-41716579
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41716579,
year = {2026},
author = {Talarico, L and Petrosino, G and Rossi, AR and Franchini, P and Tancioni, L},
title = {Controlled Experiments Reveal Moderate, Nonlinear Relationships Between eDNA Concentration and Fish Biomass in Three Freshwater Species of Monitoring Relevance.},
journal = {Ecology and evolution},
volume = {16},
number = {2},
pages = {e73129},
pmid = {41716579},
issn = {2045-7758},
abstract = {Understanding the relationship between environmental DNA (eDNA) concentration and taxa abundance is essential for the advancement of quantitative biodiversity monitoring. We experimentally manipulated biomass of three freshwater fish species of monitoring interest-the Italian-endemic Squalius lucumonis and the exotic-invasive Pseudorasbora parva and Lepomis gibbosus-under controlled conditions (flow-through 310 and 1330 L tanks). Following eDNA collection (2 L water filtration) and Real-Time PCR quantification, Generalized Additive Mixed Models (GAMMs) revealed: (i) monotonic non-linear relationships of moderate-to-high magnitude (0.42 < partial-R [2] < 0.62), with eDNA concentrations plateauing at intermediate biomasses in smaller-sized taxa; and (ii) a significant effect of experimental replicates (tanks) in two out of three species. These findings suggest that eDNA-based biomass quantification should not assume linearity, and emphasize the critical role of replication to account for inherent uncertainty, likely driven by inter- and intra-individual variations in eDNA shedding rates.},
}
RevDate: 2026-02-20
DNA barcoding for identification of ichthyofauna in Pantabangan Dam, Nueva Ecija, Philippines.
Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis [Epub ahead of print].
The present study established the first molecular-based inventory of nine freshwater fish species from Pantabangan Dam, a genetically unexplored fishery resource in Nueva Ecija, Central Luzon region of the Philippines. Forty mitochondrial cytochrome c oxidase I (COI) sequences were generated representing nine species, eight families and six orders of fishes, providing potential application in biodiversity assesment and management. In all cases, sequence analysis yielded low intraspecific divergence and a high interspecific genetic distance was observed in the Nearest Neighbor Distance analysis. Neighbor-Joining and Maximum Likelihood phylogenetic trees recovered a monophyletic species-level clades supported by high bootstrap values. Out of the nine species identified, three were native species in the Philippines (Leiopotherapon plumbeus, Glossogobius aureus and Clarias batrachus). Two species (Micropterus floridanus and Coptodon zillii) have been recorded for the first time in the dam, indicating the need to review how monitoring protocols can be enhanced by combining morphological assessment and molecular identification. The generated sequences can be used as a baseline data for the conservation of endemic species and formulation of management decisions on the invasive fishes. Overall, our study confirmed the efficiency of DNA barcoding in species delineation and offered a new framework for fish management in the dam.
Additional Links: PMID-41715976
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41715976,
year = {2026},
author = {Alcantara, SG and Juanico, CST and Ordynets, A and Fernandez, MC and Yambot, AV},
title = {DNA barcoding for identification of ichthyofauna in Pantabangan Dam, Nueva Ecija, Philippines.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {},
number = {},
pages = {1-8},
doi = {10.1080/24701394.2026.2631395},
pmid = {41715976},
issn = {2470-1408},
abstract = {The present study established the first molecular-based inventory of nine freshwater fish species from Pantabangan Dam, a genetically unexplored fishery resource in Nueva Ecija, Central Luzon region of the Philippines. Forty mitochondrial cytochrome c oxidase I (COI) sequences were generated representing nine species, eight families and six orders of fishes, providing potential application in biodiversity assesment and management. In all cases, sequence analysis yielded low intraspecific divergence and a high interspecific genetic distance was observed in the Nearest Neighbor Distance analysis. Neighbor-Joining and Maximum Likelihood phylogenetic trees recovered a monophyletic species-level clades supported by high bootstrap values. Out of the nine species identified, three were native species in the Philippines (Leiopotherapon plumbeus, Glossogobius aureus and Clarias batrachus). Two species (Micropterus floridanus and Coptodon zillii) have been recorded for the first time in the dam, indicating the need to review how monitoring protocols can be enhanced by combining morphological assessment and molecular identification. The generated sequences can be used as a baseline data for the conservation of endemic species and formulation of management decisions on the invasive fishes. Overall, our study confirmed the efficiency of DNA barcoding in species delineation and offered a new framework for fish management in the dam.},
}
RevDate: 2026-02-22
CmpDate: 2026-02-19
First Records of Two Invasive Weevils (Coleoptera, Curculionidae, Dryophthorinae) in Brazil with Quarantine Potential.
Neotropical entomology, 55(1):13.
We report the first records in Brazil of Diocalandra frumenti (Fabricius) and Polytus mellerborgii (Boheman), weevil species of potential phytosanitary concern. These detections were made through surveys in the Entomological Collection of the Universidade Federal Rural de Pernambuco (CERPE) and targeted field inspections in northeast Brazil. These findings expand the known distribution of these weevils in Brazil and underscore the need for enhanced phytosanitary surveillance due to their potential impact on crop production in other countries and the implications for quarantine regulations.
Additional Links: PMID-41714518
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41714518,
year = {2026},
author = {Lira, AO and Santos, AA and da Silva, HNB and Grossi, PC},
title = {First Records of Two Invasive Weevils (Coleoptera, Curculionidae, Dryophthorinae) in Brazil with Quarantine Potential.},
journal = {Neotropical entomology},
volume = {55},
number = {1},
pages = {13},
pmid = {41714518},
issn = {1678-8052},
support = {BFP-0103-2.04/24//Fundação de Amparo à Ciência e Tecnologia do Estado de Pernambuco/ ; 312917/2022-8 PQ2//Conselho Nacional de Desenvolvimento Científico e Tecnológico/ ; },
mesh = {Animals ; Brazil ; *Weevils/classification ; Quarantine ; *Introduced Species ; *Animal Distribution ; },
abstract = {We report the first records in Brazil of Diocalandra frumenti (Fabricius) and Polytus mellerborgii (Boheman), weevil species of potential phytosanitary concern. These detections were made through surveys in the Entomological Collection of the Universidade Federal Rural de Pernambuco (CERPE) and targeted field inspections in northeast Brazil. These findings expand the known distribution of these weevils in Brazil and underscore the need for enhanced phytosanitary surveillance due to their potential impact on crop production in other countries and the implications for quarantine regulations.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
Brazil
*Weevils/classification
Quarantine
*Introduced Species
*Animal Distribution
RevDate: 2026-03-06
CmpDate: 2026-03-06
Ecological overlap and divergence in natural and urbanized habitats in two species of sympatric anoles.
Journal of thermal biology, 136:104425.
The habitat of organisms can have a significant impact on an animal's fitness, and the ability of animals to choose suitable habitats may change with human induced global change. Urbanization in particular has had drastic effects on natural habitats including changes to the physical environment and introduction of nonnative species. Ectotherms are particularly affected by environmental changes which can impact their ability to regulate their body temperature. In this study, we compared habitat preference and the effects of habitat structure in urban and natural environments on thermal preference and thermoregulation in two species of introduced ectotherms, the brown anole, Anolis sagrei, and the bark anole, Anolis distichus. We found evidence of species- and sex-specific differences in habitat use and thermal biology related to environment (i.e. natural vs urban). The urban environment had a higher temperature and fewer available perches than the natural environment. Brown anoles were better at maintaining their preferred body temperature than bark anoles. Bark anoles occupied higher perches than brown anoles, and brown anoles exhibited a greater magnitude of sexual dimorphism in their size, habitat use, and thermal biology. The lower temperature and increased habitat space in natural environments suggests these environments are at risk of invasion by nonnative species as global warming continues, and the superior ability of brown anoles to persist and maintain their body temperatures between habitats may be a reason for their success as an invasive species across the globe.
Additional Links: PMID-41713044
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41713044,
year = {2026},
author = {Gripshover, ND and Hoffman, EG and Alexandrescu, G and Bazzani, A and Bonilla, JM and Guerra, J and Diaz, MI and Kolinsky, L and Mere, K and Perez, A and Perez, S and Rodicio, I and Santos, A and Clifton, IT and Cox, CL},
title = {Ecological overlap and divergence in natural and urbanized habitats in two species of sympatric anoles.},
journal = {Journal of thermal biology},
volume = {136},
number = {},
pages = {104425},
doi = {10.1016/j.jtherbio.2026.104425},
pmid = {41713044},
issn = {0306-4565},
mesh = {Animals ; *Ecosystem ; Female ; Male ; *Lizards/physiology ; Urbanization ; *Body Temperature Regulation ; Sympatry ; Species Specificity ; Sex Characteristics ; },
abstract = {The habitat of organisms can have a significant impact on an animal's fitness, and the ability of animals to choose suitable habitats may change with human induced global change. Urbanization in particular has had drastic effects on natural habitats including changes to the physical environment and introduction of nonnative species. Ectotherms are particularly affected by environmental changes which can impact their ability to regulate their body temperature. In this study, we compared habitat preference and the effects of habitat structure in urban and natural environments on thermal preference and thermoregulation in two species of introduced ectotherms, the brown anole, Anolis sagrei, and the bark anole, Anolis distichus. We found evidence of species- and sex-specific differences in habitat use and thermal biology related to environment (i.e. natural vs urban). The urban environment had a higher temperature and fewer available perches than the natural environment. Brown anoles were better at maintaining their preferred body temperature than bark anoles. Bark anoles occupied higher perches than brown anoles, and brown anoles exhibited a greater magnitude of sexual dimorphism in their size, habitat use, and thermal biology. The lower temperature and increased habitat space in natural environments suggests these environments are at risk of invasion by nonnative species as global warming continues, and the superior ability of brown anoles to persist and maintain their body temperatures between habitats may be a reason for their success as an invasive species across the globe.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Ecosystem
Female
Male
*Lizards/physiology
Urbanization
*Body Temperature Regulation
Sympatry
Species Specificity
Sex Characteristics
RevDate: 2026-02-19
CmpDate: 2026-02-19
Invasive mussel is rapidly spreading in Amazonian rivers.
Science (New York, N.Y.), 391(6787):750.
After devastating ecosystems and livelihoods across South America, the golden mussel fulfills a dire prediction.
Additional Links: PMID-41712716
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41712716,
year = {2026},
author = {Moutinho, S},
title = {Invasive mussel is rapidly spreading in Amazonian rivers.},
journal = {Science (New York, N.Y.)},
volume = {391},
number = {6787},
pages = {750},
doi = {10.1126/science.aeg5594},
pmid = {41712716},
issn = {1095-9203},
mesh = {Animals ; *Rivers ; *Introduced Species ; Brazil ; Ecosystem ; *Bivalvia ; South America ; },
abstract = {After devastating ecosystems and livelihoods across South America, the golden mussel fulfills a dire prediction.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Rivers
*Introduced Species
Brazil
Ecosystem
*Bivalvia
South America
RevDate: 2026-02-19
CmpDate: 2026-02-19
DNA barcoding confirms the identity of the invasive Sonchus arvensis in Java, Indonesia.
Brazilian journal of biology = Revista brasleira de biologia, 85:e296844 pii:S1519-69842025000100502.
Sonchus arvensissubsp.arvensisis a perennial plant that serves both as a traditional medicinal herb and a prolific invasive weed. Its recent introduction to Southeast Asia, including Java, Indonesia, poses a potential threat to native biodiversity, yet its genetic provenance and invasion history in the region are uncharacterized. To provide a reliable species-level identification, we employed DNA barcoding of the chloroplast genesrbcLandmatK. Phylogenetic analysis revealed that samples from the four geographically distinct areas were genetically uniform based on these markers and were placed within a clade containing EurasianS. arvensisaccessions. The invader was distinct from the native AustralasianSonchusspecies. This work represents the first molecular confirmation ofS. arvensisin Java using DNA barcodes. While it establishes species identity, further genomic studies are required to resolve the population history, introduction pathway, and ecological impact of this invasive species.
Additional Links: PMID-41711885
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41711885,
year = {2026},
author = {Habila, S and Wahyuni, DK},
title = {DNA barcoding confirms the identity of the invasive Sonchus arvensis in Java, Indonesia.},
journal = {Brazilian journal of biology = Revista brasleira de biologia},
volume = {85},
number = {},
pages = {e296844},
doi = {10.1590/1519-6984.296844},
pmid = {41711885},
issn = {1678-4375},
mesh = {*DNA Barcoding, Taxonomic/methods ; Indonesia ; *Introduced Species ; Phylogeny ; *Sonchus/genetics/classification ; *DNA, Plant/genetics ; },
abstract = {Sonchus arvensissubsp.arvensisis a perennial plant that serves both as a traditional medicinal herb and a prolific invasive weed. Its recent introduction to Southeast Asia, including Java, Indonesia, poses a potential threat to native biodiversity, yet its genetic provenance and invasion history in the region are uncharacterized. To provide a reliable species-level identification, we employed DNA barcoding of the chloroplast genesrbcLandmatK. Phylogenetic analysis revealed that samples from the four geographically distinct areas were genetically uniform based on these markers and were placed within a clade containing EurasianS. arvensisaccessions. The invader was distinct from the native AustralasianSonchusspecies. This work represents the first molecular confirmation ofS. arvensisin Java using DNA barcodes. While it establishes species identity, further genomic studies are required to resolve the population history, introduction pathway, and ecological impact of this invasive species.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
*DNA Barcoding, Taxonomic/methods
Indonesia
*Introduced Species
Phylogeny
*Sonchus/genetics/classification
*DNA, Plant/genetics
RevDate: 2026-02-19
Shell-shocked: parasite-induced behaviour and development in an invasive dead-end snail host.
The Journal of experimental biology pii:370736 [Epub ahead of print].
Parasites with complex life cycles produce large numbers of free-living infectious stages to overcome the low odds of successful transmission between hosts. These stages often infect non-competent or "dead-end" hosts, which cannot support parasite development or transmission. While typically viewed as ecological cul-de-sacs, dead-end hosts may still experience meaningful effects from parasite exposure. Here, we examine how exposure to Paragordius varius hairworm larvae influences behaviour and development of Physella acuta, an invasive freshwater snail likely functioning as a dead-end host in this system. Using a dose-response design under controlled conditions, we exposed juvenile snails to increasing larval concentrations and tracked activity over 24 hours in relation to water, total home range, and core activity areas. Snails were then reared to assess impacts on shell development. Infection intensity scaled with larval dose. At the highest exposure, snails showed an almost one-third reduction in home range, spent substantially more time submerged, and entered water less frequently but for longer durations. These shifts indicate reduced exploratory behaviour and altered water use, potentially limiting ecological flexibility. Although shell size and shape were unaffected, shell crush resistance increased markedly with dose, suggesting altered properties tied to behavioural or physiological responses. Our results show that parasites can impose sublethal yet ecologically significant costs on dead-end hosts. This challenges traditional views of dead-end hosts as passive endpoints and highlights their potential role in shaping host-parasite dynamics. For invasive species like P. acuta, even non-transmissive infections may carry fitness and ecological consequences.
Additional Links: PMID-41711011
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41711011,
year = {2026},
author = {Doherty, JF and Rossouw, B and Foster, LJ and Matthews, BJ},
title = {Shell-shocked: parasite-induced behaviour and development in an invasive dead-end snail host.},
journal = {The Journal of experimental biology},
volume = {},
number = {},
pages = {},
doi = {10.1242/jeb.251496},
pmid = {41711011},
issn = {1477-9145},
support = {PDF-578318-2023//National Sciences and Engineering Research Council of Canada/ ; RGPIN-2020-05423//National Sciences and Engineering Research Council of Canada/ ; SCH-2021-1860//Michael Smith Health Research BC/ ; },
abstract = {Parasites with complex life cycles produce large numbers of free-living infectious stages to overcome the low odds of successful transmission between hosts. These stages often infect non-competent or "dead-end" hosts, which cannot support parasite development or transmission. While typically viewed as ecological cul-de-sacs, dead-end hosts may still experience meaningful effects from parasite exposure. Here, we examine how exposure to Paragordius varius hairworm larvae influences behaviour and development of Physella acuta, an invasive freshwater snail likely functioning as a dead-end host in this system. Using a dose-response design under controlled conditions, we exposed juvenile snails to increasing larval concentrations and tracked activity over 24 hours in relation to water, total home range, and core activity areas. Snails were then reared to assess impacts on shell development. Infection intensity scaled with larval dose. At the highest exposure, snails showed an almost one-third reduction in home range, spent substantially more time submerged, and entered water less frequently but for longer durations. These shifts indicate reduced exploratory behaviour and altered water use, potentially limiting ecological flexibility. Although shell size and shape were unaffected, shell crush resistance increased markedly with dose, suggesting altered properties tied to behavioural or physiological responses. Our results show that parasites can impose sublethal yet ecologically significant costs on dead-end hosts. This challenges traditional views of dead-end hosts as passive endpoints and highlights their potential role in shaping host-parasite dynamics. For invasive species like P. acuta, even non-transmissive infections may carry fitness and ecological consequences.},
}
RevDate: 2026-02-18
Invasive plants optimize leaf nitrogen allocation in photosynthesis.
The New phytologist [Epub ahead of print].
Invasive plants often outcompete co-occurring native species by expressing acquisitive functional traits that promote high photosynthetic capacity. However, it remains unclear whether these traits are newly evolved in the introduced ('away') range or if invaders arrived preadapted with superior traits from their native ('home') range. We measured photosynthetic performance of 27 invasive species in their home and away ranges, along with 17 co-occurring native species across 414 populations in temperate forest and field habitats. To understand mechanisms of photosynthetic shifts, we quantified leaf nitrogen (N) allocation among photosynthetic, structural, and defensive functions. Invasive species had greater photosynthetic capacity and photosynthetic N allocation than natives in both habitats, despite similar total leaf N. In fields, away-range invaders increased Rubisco investment compared to home populations, enhancing carboxylation rates. In forests, invaders had greater Chl allocation and quantum yield compared to native species - advantages already present in home-range populations. Increased photosynthetic N allocation was not linked to reduced structural or defensive N pools, challenging the hypothesis that invader growth advantages come at the expense of defense. Our findings suggest that enhanced N investment in photosynthesis is a common competitive advantage of invasive species, involving both away-range evolution and preadaptation.
Additional Links: PMID-41708502
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41708502,
year = {2026},
author = {Griffin-Nolan, RJ and Bensaddek, L and Decocq, G and Hikosaka, K and Kichey, T and LeVonne, J and Mishio, M and Fridley, JD},
title = {Invasive plants optimize leaf nitrogen allocation in photosynthesis.},
journal = {The New phytologist},
volume = {},
number = {},
pages = {},
doi = {10.1111/nph.71025},
pmid = {41708502},
issn = {1469-8137},
support = {IOS-1754273//Division of Environmental Biology/ ; },
abstract = {Invasive plants often outcompete co-occurring native species by expressing acquisitive functional traits that promote high photosynthetic capacity. However, it remains unclear whether these traits are newly evolved in the introduced ('away') range or if invaders arrived preadapted with superior traits from their native ('home') range. We measured photosynthetic performance of 27 invasive species in their home and away ranges, along with 17 co-occurring native species across 414 populations in temperate forest and field habitats. To understand mechanisms of photosynthetic shifts, we quantified leaf nitrogen (N) allocation among photosynthetic, structural, and defensive functions. Invasive species had greater photosynthetic capacity and photosynthetic N allocation than natives in both habitats, despite similar total leaf N. In fields, away-range invaders increased Rubisco investment compared to home populations, enhancing carboxylation rates. In forests, invaders had greater Chl allocation and quantum yield compared to native species - advantages already present in home-range populations. Increased photosynthetic N allocation was not linked to reduced structural or defensive N pools, challenging the hypothesis that invader growth advantages come at the expense of defense. Our findings suggest that enhanced N investment in photosynthesis is a common competitive advantage of invasive species, involving both away-range evolution and preadaptation.},
}
RevDate: 2026-02-22
Knowledge mapping of world's worst invasive alien species under changing climate.
Behavioural processes, 237:105361 pii:S0376-6357(26)00035-5 [Epub ahead of print].
Climate change exerts severe impacts on aquatic ecosystems and is intrinsically linked to the behavioral expansion of alien species, potentially exacerbating existing invasion dynamics. Despite the critical role of behavioral plasticity in invasion success, there is a notable lack of comprehensive mapping studies assessing how these species adapt their physiological and behavioral responses to climatic shifts. To address these gaps, this study employs scientometric and comparative analysis to illuminate the current status and future research directions concerning the world's most problematic invasive fish and shellfish. A systematic search of the Web of Science (1975-2023) identified 7087 documents focusing on the IUCN's most harmful aquatic invaders. The findings reveal that research is increasingly focused on the mechanistic drivers of behavior, with "oxidative stress," "hypoxia," and "temperature effect" emerging as dominant research hotspots. Thematic analysis identified 38 clusters, highlighting "respiratory status" and "ocean acidification" as critical factors influencing the survival and activity patterns of invasive taxa. This analysis emphasizes that understanding the behavioral and physiological thresholds of these species is vital for strategic management, providing policymakers with a roadmap to anticipate how extreme climatic events will alter the behavior and spread of the world's worst invasive species.
Additional Links: PMID-41707699
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41707699,
year = {2026},
author = {Azra, MN and Soffa, FB and Norazmi-Lokman, NH and Segaran, TC and Wei, LS and Abdul Kari Z, Z and Gao, H and Ab Lah, R and Moss, A},
title = {Knowledge mapping of world's worst invasive alien species under changing climate.},
journal = {Behavioural processes},
volume = {237},
number = {},
pages = {105361},
doi = {10.1016/j.beproc.2026.105361},
pmid = {41707699},
issn = {1872-8308},
abstract = {Climate change exerts severe impacts on aquatic ecosystems and is intrinsically linked to the behavioral expansion of alien species, potentially exacerbating existing invasion dynamics. Despite the critical role of behavioral plasticity in invasion success, there is a notable lack of comprehensive mapping studies assessing how these species adapt their physiological and behavioral responses to climatic shifts. To address these gaps, this study employs scientometric and comparative analysis to illuminate the current status and future research directions concerning the world's most problematic invasive fish and shellfish. A systematic search of the Web of Science (1975-2023) identified 7087 documents focusing on the IUCN's most harmful aquatic invaders. The findings reveal that research is increasingly focused on the mechanistic drivers of behavior, with "oxidative stress," "hypoxia," and "temperature effect" emerging as dominant research hotspots. Thematic analysis identified 38 clusters, highlighting "respiratory status" and "ocean acidification" as critical factors influencing the survival and activity patterns of invasive taxa. This analysis emphasizes that understanding the behavioral and physiological thresholds of these species is vital for strategic management, providing policymakers with a roadmap to anticipate how extreme climatic events will alter the behavior and spread of the world's worst invasive species.},
}
RevDate: 2026-02-18
Evaluation of acute toxicity and enzyme activity of commonly used pesticides in rice fields to Chironomus kiiensis and Chironomus javanus.
Ecotoxicology (London, England), 35(3):54.
Additional Links: PMID-41706345
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41706345,
year = {2026},
author = {Chen, L and Guo, J and Yang, Y and Xu, H and Lu, Z and Zheng, X and Wu, Y and Lu, Y},
title = {Evaluation of acute toxicity and enzyme activity of commonly used pesticides in rice fields to Chironomus kiiensis and Chironomus javanus.},
journal = {Ecotoxicology (London, England)},
volume = {35},
number = {3},
pages = {54},
pmid = {41706345},
issn = {1573-3017},
support = {CARS-01//earmarked fund for the China Agriculture Research System/ ; 2023YFD1400800//National Key Research and Development Program of China/ ; },
}
RevDate: 2026-02-18
CmpDate: 2026-02-18
Wild ungulate foraging suppresses growth of invasive parthenium weed.
Biology letters, 22(2):.
The invasive weed Parthenium hysterophorus has severely disrupted ecosystems worldwide, driven by its persistent seed bank and phytotoxic compounds that suppress surrounding vegetation and negatively impact herbivorous mammals. It is widely assumed that wild ungulates avoid parthenium weed-dominated areas due to its presumed unpalatability and toxicity, but direct evidence is limited. We experimentally tested whether ungulates in an African savanna actively forage on parthenium weed by contrasting herbivore foraging in mechanically cleared and controlled areas using exclosures in parthenium-invaded areas. We also assessed whether reduction in body condition scores was associated with foraging on parthenium weed, and whether herbivory suppresses parthenium weed regrowth. Our experimental results show that ungulates foraged on parthenium rosettes without apparent negative impacts on body condition. Notably, herbivore activity significantly reduced parthenium cover in cleared areas. These findings reveal a previously undocumented potential for leveraging wild ungulate herbivory as a biocontrol mechanism for managing parthenium weed invasions.
Additional Links: PMID-41705387
Publisher:
PubMed:
Citation:
show bibtex listing
hide bibtex listing
@article {pmid41705387,
year = {2026},
author = {Glennon, KL and Theron, A and Pedroza Lopez, E and Fletcher, RJ and Botero-Cañola, S and Kruger, L and Lasky, M and Monadjem, A and Wisely, SM and McCleery, R},
title = {Wild ungulate foraging suppresses growth of invasive parthenium weed.},
journal = {Biology letters},
volume = {22},
number = {2},
pages = {},
doi = {10.1098/rsbl.2025.0623},
pmid = {41705387},
issn = {1744-957X},
support = {//National Science Foundation International Experience for Students/ ; //NRF/ ; },
mesh = {Animals ; *Herbivory ; *Introduced Species ; *Plant Weeds/growth & development ; *Asteraceae/growth & development ; *Feeding Behavior ; Kenya ; },
abstract = {The invasive weed Parthenium hysterophorus has severely disrupted ecosystems worldwide, driven by its persistent seed bank and phytotoxic compounds that suppress surrounding vegetation and negatively impact herbivorous mammals. It is widely assumed that wild ungulates avoid parthenium weed-dominated areas due to its presumed unpalatability and toxicity, but direct evidence is limited. We experimentally tested whether ungulates in an African savanna actively forage on parthenium weed by contrasting herbivore foraging in mechanically cleared and controlled areas using exclosures in parthenium-invaded areas. We also assessed whether reduction in body condition scores was associated with foraging on parthenium weed, and whether herbivory suppresses parthenium weed regrowth. Our experimental results show that ungulates foraged on parthenium rosettes without apparent negative impacts on body condition. Notably, herbivore activity significantly reduced parthenium cover in cleared areas. These findings reveal a previously undocumented potential for leveraging wild ungulate herbivory as a biocontrol mechanism for managing parthenium weed invasions.},
}
MeSH Terms:
show MeSH Terms
hide MeSH Terms
Animals
*Herbivory
*Introduced Species
*Plant Weeds/growth & development
*Asteraceae/growth & development
*Feeding Behavior
Kenya
▼ ▼ LOAD NEXT 100 CITATIONS
ESP Quick Facts
ESP Origins
In the early 1990's, Robert Robbins was a faculty member at Johns Hopkins, where he directed the informatics core of GDB — the human gene-mapping database of the international human genome project. To share papers with colleagues around the world, he set up a small paper-sharing section on his personal web page. This small project evolved into The Electronic Scholarly Publishing Project.
ESP Support
In 1995, Robbins became the VP/IT of the Fred Hutchinson Cancer Research Center in Seattle, WA. Soon after arriving in Seattle, Robbins secured funding, through the ELSI component of the US Human Genome Project, to create the original ESP.ORG web site, with the formal goal of providing free, world-wide access to the literature of classical genetics.
ESP Rationale
Although the methods of molecular biology can seem almost magical to the uninitiated, the original techniques of classical genetics are readily appreciated by one and all: cross individuals that differ in some inherited trait, collect all of the progeny, score their attributes, and propose mechanisms to explain the patterns of inheritance observed.
ESP Goal
In reading the early works of classical genetics, one is drawn, almost inexorably, into ever more complex models, until molecular explanations begin to seem both necessary and natural. At that point, the tools for understanding genome research are at hand. Assisting readers reach this point was the original goal of The Electronic Scholarly Publishing Project.
ESP Usage
Usage of the site grew rapidly and has remained high. Faculty began to use the site for their assigned readings. Other on-line publishers, ranging from The New York Times to Nature referenced ESP materials in their own publications. Nobel laureates (e.g., Joshua Lederberg) regularly used the site and even wrote to suggest changes and improvements.
ESP Content
When the site began, no journals were making their early content available in digital format. As a result, ESP was obliged to digitize classic literature before it could be made available. For many important papers — such as Mendel's original paper or the first genetic map — ESP had to produce entirely new typeset versions of the works, if they were to be available in a high-quality format.
ESP Help
Early support from the DOE component of the Human Genome Project was critically important for getting the ESP project on a firm foundation. Since that funding ended (nearly 20 years ago), the project has been operated as a purely volunteer effort. Anyone wishing to assist in these efforts should send an email to Robbins.
ESP Plans
With the development of methods for adding typeset side notes to PDF files, the ESP project now plans to add annotated versions of some classical papers to its holdings. We also plan to add new reference and pedagogical material. We have already started providing regularly updated, comprehensive bibliographies to the ESP.ORG site.
ESP Picks from Around the Web (updated 28 JUL 2024 )
Old Science
Weird Science
Treating Disease with Fecal Transplantation
Fossils of miniature humans (hobbits) discovered in Indonesia
Paleontology
Dinosaur tail, complete with feathers, found preserved in amber.
Astronomy
Mysterious fast radio burst (FRB) detected in the distant universe.
Big Data & Informatics
Big Data: Buzzword or Big Deal?
Hacking the genome: Identifying anonymized human subjects using publicly available data.