@article {pmid42667975,
year = {2026},
author = {Li, J and Zhu, C and Chai, G and He, F and Song, Z and Chen, Z and Chen, M and Yi, Z},
title = {Progressive evolutionary trajectories of mitochondrion-related organelles in anaerobic ciliates (Eukaryota, Alveolata) revealed by APM ciliates and a facultatively anaerobic spirotrichean species.},
journal = {Molecular phylogenetics and evolution},
volume = {},
number = {},
pages = {108721},
doi = {10.1016/j.ympev.2026.108721},
pmid = {42667975},
issn = {1095-9513},
abstract = {Ciliates are an excellent model for studying convergent transitions from mitochondria to mitochondrion-related organelles (MROs) in protists. Despite our growing knowledge of adaptive evolution in ciliate MROs, the progressive evolutionary trajectories within anaerobic ciliate lineages and the MRO metabolisms of facultatively anaerobic ciliates remain unexplored. In this study, we predicted MRO metabolisms of eight species within the anaerobic monophyletic APM (Armophorea-Muranotrichea-Parablepharismea) clade and a facultative anaerobe from its sister class Spirotrichea. Our main results are as follows: (1) During their adaptation to anaerobic environments, the MRO electron transfer chain (ETC) components and their associated functions have been progressively lost in the APM clade. (2) The MRO of the last common ancestor of Armophorea likely possesses complexes Ⅰ, Ⅱ, and Ⅴ, but lacks functional complexes Ⅲ and Ⅳ. Subsequently, during their adaptation to anaerobic environments, the armophorean lineage has further lost complex Ⅴ in the order Clevelandellida and Metopida. (3) In the MRO of the facultatively anaerobic ciliate Heterodeviata sinica, complexes Ⅲ and Ⅳ are absent, and alternative oxidases (AOX) play a key role in adaptation to fluctuating dissolved oxygen levels. (4) The fused [FeFe]-hydrogenase appears to have been acquired by the last common ancestor of ciliates through horizontal gene transfer (HGT), followed by multiple independent losses. Our results provide insights into the progressive adaptations of anaerobic ciliates to the low-oxygen environments.},
}

@article {pmid26258511,
year = {2016},
author = {Li, Y and Lu, J and Wang, Z},
title = {Complete mitochondrial genome of Lasiopodomys mandarinus mandarinus (Arvicolinae, Rodentia).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {2},
pages = {1459-1460},
doi = {10.3109/19401736.2014.953092},
pmid = {26258511},
issn = {2470-1408},
mesh = {Animals ; Arvicolinae/*genetics ; Base Composition ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Phylogeny ; Sequence Analysis, DNA/methods ; },
abstract = {Mandarin voles (Lasiopodomys mandarinus) is a subterranean rodent species that are often used as a model for studying subterranean hypoxic stress in mammals. Its subspecies L. m. mandarinus span in cropland in most area of north China and is regarded as an agricultural pest. In this paper, the complete mitochondrial genome of L. m. mandarinus has been determined. Our results showed that the mitochondrial genome of L. m. mandarinus is a circular molecule of 16,367 bp, which contents 13 protein-coding, 22 tRNAs and 2 rRNAs genes. The overall base composition of the heavy strand is 32.47% A, 27.04% T, 27.01% C, and 13.47% G. with an AT content of 59.51%.},
}

Animals
Arvicolinae/*genetics
Base Composition
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Phylogeny
Sequence Analysis, DNA/methods

@article {pmid26258516,
year = {2016},
author = {Hu, J and Chen, Y and Zhao, H and Yang, H and Liu, L},
title = {Complete mitochondrial genome of Rhodeus ocellatus (Cypriniformes: Cyprinidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3489-3490},
doi = {10.3109/19401736.2015.1066362},
pmid = {26258516},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Cyprinidae/*genetics ; DNA, Ribosomal/genetics ; Gene Order ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {The complete mitogenome sequence of Rhodeus ocellatus (Kner) was determined using the next-generation sequencing (NGS). The genome was 16 761 bp in length and contained 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes and a control region. The overall nucleotide composition was 30.43% A, 27.50% T, 25.94% C, and 16.13% G, with an A + T bias of 57.93%. The gene composition and the arrangement of the R. ocellatus mitochondrial genome were similar to that of most other vertebrates. The complete mitochondrial genome sequence will help to study the evolutionary relationships and population genetics of Rhodeus fish.},
}

Animals
Base Composition
Cyprinidae/*genetics
DNA, Ribosomal/genetics
Gene Order
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods

@article {pmid26258518,
year = {2016},
author = {Wu, Z and Li, X},
title = {Complete mitochondrial genome of the Nemipterus virgatus (Perciformes: Nemipteridae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3485-3486},
doi = {10.3109/19401736.2015.1066360},
pmid = {26258518},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; DNA, Ribosomal/genetics ; Gene Order ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Perciformes/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {The complete mitochondrial genome of the Nemipterus virgatus has been sequenced. The mitochondrial genome is 16 992 bp in length, containing 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and one control region. The gene order and composition of N. virgatus mitochondrial genome was similar to that of most other vertebrates. The overall nucleotides base composition of the light strand is A (27.89%), G (26.61%), C (16.45%), T (29.05%). With the exception of the NADH dehydrogenase subunit 6 (ND6) and eight tRNA genes, all other mitochondrial genes are encoded on the heavy strand. The tRNA-Ser2 gene lacked DHC arm and could not fold into a typical clover-leaf secondary structure. Seen from the phylogenetic tree, N. virgatus, Nemipterus japonicus, and Nemipterus bathybius from the same genus clustered into one branch.},
}

Animals
Base Composition
DNA, Ribosomal/genetics
Gene Order
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Perciformes/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods

@article {pmid26258519,
year = {2016},
author = {Yu, P and Ding, S and Yang, Q and Li, X and Wan, Q},
title = {The complete mitochondrial genome of Sinibotia robusta (Cypriniformes: Cobitidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3471-3472},
doi = {10.3109/19401736.2015.1066353},
pmid = {26258519},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Cypriniformes/*genetics ; DNA, Ribosomal/genetics ; Gene Order ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {The Sinibotia robusta mitochondrial genome (GenBank accession no. KP979711) was a circular molecule of 16 575 bp in length, with two rRNA genes, 13 protein-coding genes, 22 tRNA genes, an l-strand replication origin (OL), and a control region (D-loop). The nucleotide acid composition of the entire mitogenome was 31.91% for A, 26.90% for C, 15.56% for G, and 25.63% for T, with an A + T content of 57.54%. And the A + T content of 12S rRNA, 16S rRNA, and D-loop was 51.26%, 56.17%, and 67.73%, respectively.},
}

Animals
Base Composition
Cypriniformes/*genetics
DNA, Ribosomal/genetics
Gene Order
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods

@article {pmid26260170,
year = {2016},
author = {Luo, X and Kang, X and Zhang, D},
title = {Complete mitochondrial genome of the American flamingo, Phoenicopterus ruber (Phoenicopteriformes, Phoenicopteridae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3519-3520},
doi = {10.3109/19401736.2015.1074198},
pmid = {26260170},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Birds/*genetics ; DNA, Ribosomal/genetics ; Gene Order ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; United States ; },
abstract = {The American flamingo, Phoenicopterus ruber (P. ruber), is a large species of flamingo closely related to the greater flamingo and Chilean flamingo. In this paper, the complete mitochondrial genome sequence of P. ruber has been assembled for the first time. It was 17 476 bp in length and consisted of 13 typical vertebrate protein-coding genes, 22 tRNA genes, 2 rRNA genes and 2 control regions. COI and ND3 genes used GTG and ATC as start codons respectively, but the remaining protein-coding genes were encoded beginning with orthodox ATG codon. Two triplet codons (TAA, AGG) and one single T base were employed as stop codons. The arrangement of the overall genes and noncoding regions was identical to the same genus flamingo Phoenicopterus roseus. The AT content (54.27%) was higher than the GC content. Phylogenetic analysis was performed using 12 protein-coding genes, combined with other 11 species from the same Neognathae, which validated the responsibility and utility of this new mitochondrial genome.},
}

Animals
Base Composition
Birds/*genetics
DNA, Ribosomal/genetics
Gene Order
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods
United States

@article {pmid26260172,
year = {2016},
author = {Park, CE and Park, GS and Kim, MC and Kim, KH and Park, HC and Lee, IJ and Shin, JH},
title = {Complete mitochondrial genome of the Korean endemic species Microphysogobio yaluensis (Teleostei, Cypriniformes, Cyprinidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3557-3559},
doi = {10.3109/19401736.2015.1074217},
pmid = {26260172},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Cyprinidae/*genetics ; Genes, rRNA ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Republic of Korea ; Sequence Analysis, DNA/*methods ; },
abstract = {In this study, we sequenced the complete mitochondrial genome of the Korean endemic species Microphysogobio yaluensis (Teleostei, Cypriniformes, Cyprinidae). The mitogenome, consisted of 16 601 base pairs (bp), encoding 13 protein-coding genes (PCGs), 2 ribosomal RNAs (rRNAs), 22 transfer RNAs (tRNAs) and 2 non-coding regions. The overall base composition of M. yaluensis was G + C: 43.8%, A + T: 56.2%, apparently with a slight AT bias. Phylogenetic analysis showed that M. yaluensis was close to Hemibarbus mylodon.},
}

Animals
Base Composition
Cyprinidae/*genetics
Genes, rRNA
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Phylogeny
RNA, Transfer/genetics
Republic of Korea
Sequence Analysis, DNA/*methods

@article {pmid26260173,
year = {2016},
author = {Yang, X and Xie, GL and Wu, XP and Ouyang, S},
title = {The complete mitochondrial genome of Chinese land snail Aegista aubryana (Gastropoda: Pulmonata: Bradybaenidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3538-3539},
doi = {10.3109/19401736.2015.1074207},
pmid = {26260173},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; China ; Genes, rRNA ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; Snails/*genetics ; },
abstract = {Aegista aubryana is an endemic land snail in China. The complete mitochondrial genome of A. aubryana was first determined using long PCR reactions and primer walking method (accession number KT192071). The genome has a length of 14 238 bp, containing 37 typical mitochondrial genes (13 protein-coding genes, 22 tRNA genes and 2 rRNA genes). The base composition of the whole heavy strand is A 31.32%, T 37.86%, C 14.46% and G 16.36%. The results of phylogenetic analyses showed that the A. aubryana is most closely related to Mastigeulota kiangsinensis. This new complete mitochondrial genome can be the basic data for further studies on mitogenome comparison, molecular taxonomy and phylogenetic analyses in bradybaenid snails and Molluscs at large.},
}

Animals
Base Composition
China
Genes, rRNA
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods
Snails/*genetics

@article {pmid26260175,
year = {2016},
author = {Wilson, JJ and Hefner, M and Walker, CW and Page, ST},
title = {Complete mitochondrial genome of the soft-shell clam Mya arenaria.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3553-3554},
pmid = {26260175},
issn = {2470-1408},
support = {P20 GM103423/GM/NIGMS NIH HHS/United States ; },
mesh = {Animals ; Base Composition ; Gene Order ; Genes, rRNA ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Mya/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {We have sequenced and characterized the complete mitochondrial genome of the soft-shell clam, Mya arenaria, an important organism for environmental toxicology and aquaculture. Mya arenaria is located in the taxonomic order Myoida, which lacks any member with a completely annotated mitogenome. The M. arenaria mitochondrial genome is 17 947 bp in length. Like most marine bivalves, the circular mitogenome codes entirely on the heavy strand, with no introns. As with other bivalves, the gene order of the mitochondrion is highly rearranged. The mitogenome contains 12 protein-coding genes but ATP8 is missing, consistent with about half of all bivalve genera. Twenty-three tRNAs were identified. Phylogenetic analysis shows that M. arenaria is related most closely with the bivalves Sinonovacula constricta, and Moerella iridescens, of the infraclass Euheterodonta (unassigned). This, along with the close grouping of the phylogenetic trees, confirms a close tie between Myoida and Euheterodonta (unassigned).},
}

Animals
Base Composition
Gene Order
Genes, rRNA
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Mya/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods

@article {pmid26260177,
year = {2016},
author = {Zhang, G and Wang, R and Mao, J and Yin, S and Tao, P and Chen, J and Yu, X and Tang, Z and Chen, S},
title = {The complete mitochondrial genome and phylogenic analysis of Pseudobagrus vachelli.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3551-3552},
doi = {10.3109/19401736.2015.1074213},
pmid = {26260177},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Catfishes/*genetics ; Gene Order ; Genes, rRNA ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {The complete mitochondrial genome of Pseudobagrus vachelli has been sequenced. The mitochondrial genome is 16 529 bp in length, with the base composition of 31.61% A, 26.88% T, 26.55% C, and 14.96% G, containing 2 ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and a major non-coding control region (D-loop region). The gene order and orientation are similar with some typical fish species. The data will provide useful molecular information for phylogenetic studies concerning P. vachelli and its related species.},
}

Animals
Base Composition
Catfishes/*genetics
Gene Order
Genes, rRNA
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods

@article {pmid26260179,
year = {2016},
author = {Li, Y and Yao, J and Zhao, X and Li, L and Yan, S},
title = {Complete mitochondrial genome sequence of Chestnut-flanked white-eye (Zosterops erythropleurus).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3529-3530},
doi = {10.3109/19401736.2015.1074203},
pmid = {26260179},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Genes, rRNA ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Passeriformes/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {The Chestnut-flanked white-eye (Zosterops erythropleurus) is a species of family Zosteropidae, which is distributed widely in the world. In the present study, the complete mitochondrial genome sequence of Chestnut-flanked white-eye was determined. It has a total length of 17 811 bp, and contains 13 protein-coding genes, 22 tRNA genes, 2 ribosome RNA genes and 2 control regions. The total base composition was 30.2% for A, 31.0% for C, 14.2% for G and 24.6% for T. The phylogenetic tree of Chestnut-flanked white-eye and 13 other species belonging to the order Passeriformes was built. The molecular data presented here will be useful to study the evolutionary relationships and genetic diversity of Chestnut-flanked white-eye.},
}

Animals
Base Composition
Genes, rRNA
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Passeriformes/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods

@article {pmid26260184,
year = {2016},
author = {Das, SP and Bit, A and Patnaik, S and Sahoo, L and Meher, PK and Jayasankar, P and Saha, TM and Patel, AB and Patel, N and Koringa, P and Joshi, CG and Agarwal, S and Pandey, M and Srivastava, S and Kushwaha, B and Kumar, R and Nagpure, NS and Iquebal, MA and Jaiswal, S and Kumar, D and Jena, JK and Das, P},
title = {Low-depth shotgun sequencing resolves complete mitochondrial genome sequence of Labeo rohita.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3517-3518},
doi = {10.3109/19401736.2015.1074197},
pmid = {26260184},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Cyprinidae/*genetics ; DNA, Ribosomal/genetics ; Gene Order ; Genome Size ; Genome, Mitochondrial ; High-Throughput Nucleotide Sequencing/*methods ; Mitochondria/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {Labeo rohita, popularly known as rohu, is a widely cultured species in whole Indian subcontinent. In the present study, we used in-silico approach to resolve complete mitochondrial genome of rohu. Low-depth shotgun sequencing using Roche 454 GS FLX (Branford, Connecticut, USA) followed by de novo assembly in CLC Genomics Workbench version 7.0.4 (Aarhus, Denmark) revealed the complete mitogenome of L. rohita to be 16 606 bp long (accession No. KR185963). It comprised of 13 protein-coding genes, 22 tRNAs, 2 rRNAs and 1 putative control region. The gene order and organization are similar to most vertebrates. The mitogenome in the present investigation has 99% similarity with that of previously reported mitogenomes of rohu and this is also evident from the phylogenetic study using maximum-likelihood (ML) tree method. This study was done to determine the feasibility, accuracy and reliability of low-depth sequence data obtained from NGS platform as compared to the Sanger sequencing. Thus, NGS technology has proven to be competent and a rapid in-silico alternative to resolve the complete mitochondrial genome sequence, thereby reducing labors and time.},
}

Animals
Base Composition
Cyprinidae/*genetics
DNA, Ribosomal/genetics
Gene Order
Genome Size
Genome, Mitochondrial
High-Throughput Nucleotide Sequencing/*methods
Mitochondria/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods

@article {pmid26260186,
year = {2016},
author = {Li, W and Liu, Y and Xu, Q},
title = {Complete mitochondrial genome of Schizothorax nukiangensis Tsao (Cyprinidae: Schizothorax).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3549-3550},
doi = {10.3109/19401736.2015.1074212},
pmid = {26260186},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Cyprinidae/*genetics ; Genes, rRNA ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {In this work, we reported the complete mitochondrial genome sequence of the Schizothorax nukiangensis Tsao for the first time. The complete mtDNA genome sequence of S. nukiangensis Tsao was 16 585 bp in length, which contains 22 transfer RNA genes, 2 rRNA genes, 13 protein-coding genes, an origin of light-strand replication (OL) and a control region (D-Loop). The overall base composition of the mitogenome was calculated to be 29.6% for A, 27.0% for C, 17.9% for G and 25.5% for T. The complete mitogenome of the S. nukiangensis Tsao can provide an important data set for further studies on population history, molecular systematics, phylogeography and stock assessment.},
}

Animals
Base Composition
Cyprinidae/*genetics
Genes, rRNA
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods

@article {pmid26267495,
year = {2015},
author = {Kumar Singh, M and Janardhan Reddy, PV and Sreedhar, AS and Tiwari, PK},
title = {Molecular characterization and expression analysis of hsp60 gene homologue of sheep blowfly, Lucilia cuprina.},
journal = {Journal of thermal biology},
volume = {52},
number = {},
pages = {24-37},
doi = {10.1016/j.jtherbio.2015.05.001},
pmid = {26267495},
issn = {0306-4565},
mesh = {Adenosine Triphosphate/metabolism ; Amino Acid Sequence ; Animals ; Cell Nucleus/metabolism/physiology ; Chaperonin 60/biosynthesis/*genetics ; Cloning, Molecular ; Diptera/*physiology ; Gene Expression Regulation/*genetics/*physiology ; Heat-Shock Response/genetics/physiology ; Hot Temperature ; Introns ; Larva/metabolism ; Mitochondria/metabolism ; Molecular Sequence Data ; Phylogeny ; Polymerase Chain Reaction ; Temperature ; },
abstract = {The 60kDa heat shock protein (Hsp60) or chaperonin is one among the highly conserved families of heat shock proteins, known to be involved in variety of cellular activities, including protein folding, thermal protection, etc. In this study we sequence characterized hsp60 gene homologue of Lucilia cuprina, isolated and cloned from the genomic library as well as by genomic PCR, followed by RACE- PCR. The L. cuprina hsp60 gene/protein expression pattern was analyzed in various tissues, either at normal temperature (25±1°C) or after exposure to heat stress (42°C). The analysis of nucleotide sequence of Lchsp60 gene revealed absence of intron and the nuclear localizing signal (NLS). The deduced amino acid sequence showed presence of unique conserved sequences, such as those for mitochondrial localization, ATP binding, etc. Unlike Drosophila, Lucilia showed presence of only one isoform, i.e., hsp60A. Phylogenetic analysis of hsp60 gene homologues from different species revealed Lchsp60 to have >88.36% homology with D. melanogaster, 76.86% with L. sericata, 58.31% with mice, 57.99% with rat, and 57.72% with human. Expression analysis using Real Time PCR and fluorescence imaging showed significant enhancement in the expression level of Lchsp60 upon heat stress in a tissue specific manner, indicating its likely role in thermo-tolerance as well as in normal cellular activities.},
}

Adenosine Triphosphate/metabolism
Amino Acid Sequence
Animals
Cell Nucleus/metabolism/physiology
Chaperonin 60/biosynthesis/*genetics
Cloning, Molecular
Diptera/*physiology
Gene Expression Regulation/*genetics/*physiology
Heat-Shock Response/genetics/physiology
Hot Temperature
Introns
Larva/metabolism
Mitochondria/metabolism
Molecular Sequence Data
Phylogeny
Polymerase Chain Reaction
Temperature

@article {pmid26273922,
year = {2016},
author = {Jang, YS and Kim, S and Kim, KY and Park, JH},
title = {Complete mitochondrial genome of Sebastes taczanowskii (Scorpaenidae, Scorpaeniformes) from the East Sea, Korea.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3531-3533},
doi = {10.3109/19401736.2015.1074204},
pmid = {26273922},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Genes, rRNA ; Genome Size ; *Genome, Mitochondrial ; High-Throughput Nucleotide Sequencing ; Mitochondria/*genetics ; Perciformes/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Republic of Korea ; Sequence Analysis, DNA/*methods ; },
abstract = {Sebastes taczanowskii is a subarctic species in the north-western Pacific Ocean. To obtain mitochondrial DNA sequences for phylogeny, the complete mitogenome (16 452 bp in length) of S. taczanowskii was constructed using next-generation sequencing. The circular mitogenome contains 13 protein-coding genes (PCGs), 2 rRNAs, 22 tRNAs and the control region, for which gene structure and positions were similar to those of other Scorpaenidae. The complete mitogenome composed of 27.8% A, 26.5% T, 17.3% G and 28.5% C, with a slight AT bias (54.3%). All PCGs use a typical start codon, ATG, except COX1 (GTG). The terminal codon of PCGs was mainly TAR, with the exceptions of ND4 (AGA) and Cytb (incomplete codon, T). Sebastes taczanowskii was clearly divided from other Scorpaenidae in the phylogenetic tree using 2 rRNA and 13 PCGs. The mitogenome of S. taczanowskii can be useful for constructing the molecular phylogenetic tree within Scorpaenidae.},
}

Animals
Base Composition
Genes, rRNA
Genome Size
*Genome, Mitochondrial
High-Throughput Nucleotide Sequencing
Mitochondria/*genetics
Perciformes/*genetics
Phylogeny
RNA, Transfer/genetics
Republic of Korea
Sequence Analysis, DNA/*methods

@article {pmid26277108,
year = {2015},
author = {Horáková, E and Changmai, P and Paris, Z and Salmon, D and Lukeš, J},
title = {Simultaneous depletion of Atm and Mdl rebalances cytosolic Fe-S cluster assembly but not heme import into the mitochondrion of Trypanosoma brucei.},
journal = {The FEBS journal},
volume = {282},
number = {21},
pages = {4157-4175},
doi = {10.1111/febs.13411},
pmid = {26277108},
issn = {1742-4658},
mesh = {ATP-Binding Cassette Transporters/antagonists & inhibitors/genetics/*metabolism ; Aconitate Hydratase/metabolism ; Cytosol/metabolism ; Fumarate Hydratase/metabolism ; Gene Knockdown Techniques ; Genes, Protozoan ; Genetic Complementation Test ; Heme/metabolism ; Iron-Sulfur Proteins/metabolism ; Mitochondria/metabolism ; Models, Biological ; ATP-Binding Cassette, Sub-Family C Proteins/antagonists & inhibitors/genetics/metabolism ; Phylogeny ; Protozoan Proteins/antagonists & inhibitors/genetics/*metabolism ; Saccharomyces cerevisiae/genetics/metabolism ; Trypanosoma brucei brucei/genetics/*metabolism ; },
abstract = {ABC transporter mitochondrial 1 (Atm1) and multidrug resistance-like 1 (Mdl) are mitochondrial ABC transporters. Although Atm1 was recently suggested to transport different forms of glutathione from the mitochondrion, which are used for iron-sulfur (Fe-S) cluster maturation in the cytosol, the function of Mdl remains elusive. In Trypanosoma brucei, we identified one homolog of each of these genes, TbAtm and TbMdl, which were downregulated either separately or simultaneously using RNA interference. Individual depletion of TbAtm and TbMdl led to limited growth defects. In cells downregulated for TbAtm, the enzymatic activities of the Fe-S cluster proteins aconitase and fumarase significantly decreased in the cytosol but not in the mitochondrion. Downregulation of TbMdl did not cause any change in activities of the Fe-S proteins. Unexpectedly, the simultaneous downregulation of TbAtm and TbMdl did not result in any growth defect, nor were the Fe-S cluster protein activities altered in either the cytosolic or mitochondrial compartments. Additionally, TbAtm and TbMdl were able to partially restore the growth of the Saccharomyces cerevisiae Δatm1 and Δmdl2 null mutants, respectively. Because T. brucei completely lost the heme b biosynthesis pathway, this cofactor has to be obtained from the host. Based on our results, TbMdl is a candidate for mitochondrial import of heme b, which was markedly decreased in both TbMdl and TbAtm + TbMdl knockdowns. Moreover, the levels of heme a were strongly decreased in the same knockdowns, suggesting that TbMdl plays a key role in heme a biosynthesis, thus affecting the overall heme homeostasis in T. brucei.},
}

ATP-Binding Cassette Transporters/antagonists & inhibitors/genetics/*metabolism
Aconitate Hydratase/metabolism
Cytosol/metabolism
Fumarate Hydratase/metabolism
Gene Knockdown Techniques
Genes, Protozoan
Genetic Complementation Test
Heme/metabolism
Iron-Sulfur Proteins/metabolism
Mitochondria/metabolism
Models, Biological
ATP-Binding Cassette, Sub-Family C Proteins/antagonists & inhibitors/genetics/metabolism
Phylogeny
Protozoan Proteins/antagonists & inhibitors/genetics/*metabolism
Saccharomyces cerevisiae/genetics/metabolism
Trypanosoma brucei brucei/genetics/*metabolism

@article {pmid26280086,
year = {2015},
author = {Farhadi, M and Fazaeli, A and Haniloo, A},
title = {Genetic characterization of livestock and human hydatid cyst isolates from northwest Iran, using the mitochondrial cox1 gene sequence.},
journal = {Parasitology research},
volume = {114},
number = {12},
pages = {4363-4370},
pmid = {26280086},
issn = {1432-1955},
mesh = {Animals ; Cattle ; Cattle Diseases/*parasitology ; Cyclooxygenase 1/*genetics ; Echinococcosis/*parasitology/*veterinary ; Echinococcus granulosus/classification/enzymology/genetics/*isolation & purification ; Genotype ; Helminth Proteins/*genetics ; Humans ; Iran ; Livestock ; Mitochondria/*enzymology/genetics ; Molecular Sequence Data ; Phylogeny ; Polymerase Chain Reaction ; Sheep/parasitology ; Sheep Diseases/*parasitology ; Sheep, Domestic/genetics ; },
abstract = {Cystic echinococcosis (CE), caused by larval stages of the tapeworm Echinococcus granulosus, is one of the most important zoonoses distributed worldwide. Genotype analysis of the parasite isolates from various hosts is required to better understand the host specificity and transmission routes. The aim of this study was to identify the genotypes of E. granulosus isolated from humans and domestic animals from northwest of Iran (Zanjan Province) using the mitochondrial cox1 gene sequence. A total of 86 hydatid cysts including 49 sheep and 28 cattle isolates from the slaughterhouse and nine human isolates from surgical wards of local hospitals were collected. The isolates were subjected to DNA extraction, PCR amplification, and sequence. Eighty-two (95.35 %) isolates, including 47 sheep, 26 cattle, and all nine human isolates, were determined as G1 genotype, and the remaining four (4.65 %), including two sheep and two cattle isolates, were identified as G3 genotype. From the cox1 sequence data, 13 different haplotypes (10 G1s and three G3s) were detected and named as EGH1-EGH13 (GenBank accession numbers, KP859559-KP859571). EGH1 was the major variant among the haplotypes, and it was identified in 46 (53.49 %) isolates (31 sheep, 14 cattle, and one human). Alignment of the partial cox1 sequences showed 12 point mutations including seven (58.3 %) synonymous and five (41.7 %) non-synonymous substitutions. Based on the results, G1 was the major genotype of E. granulosus in northwest of Iran affecting sheep, cattle, and humans. In addition, a minor group of G3 genotype was found to be circulating in this region.},
}

Animals
Cattle
Cattle Diseases/*parasitology
Cyclooxygenase 1/*genetics
Echinococcosis/*parasitology/*veterinary
Echinococcus granulosus/classification/enzymology/genetics/*isolation & purification
Genotype
Helminth Proteins/*genetics
Humans
Iran
Livestock
Mitochondria/*enzymology/genetics
Molecular Sequence Data
Phylogeny
Polymerase Chain Reaction
Sheep/parasitology
Sheep Diseases/*parasitology
Sheep, Domestic/genetics

@article {pmid26285652,
year = {2015},
author = {Yu, G and Xiang, H and Tian, J and Yin, J and Pinkert, CA and Li, Q and Zhao, X},
title = {Mitochondrial Haplotypes Influence Metabolic Traits in Porcine Transmitochondrial Cybrids.},
journal = {Scientific reports},
volume = {5},
number = {},
pages = {13118},
pmid = {26285652},
issn = {2045-2322},
mesh = {Adenosine Triphosphate/metabolism ; Animals ; Base Sequence ; Cell Line ; Genome, Mitochondrial/genetics ; Haplotypes/*genetics ; Hybrid Cells/*metabolism ; Mitochondria/*genetics ; Mutation, Missense/genetics ; Phylogeny ; Reactive Oxygen Species/metabolism ; Reproducibility of Results ; Succinate Dehydrogenase/metabolism ; Sus scrofa/*genetics ; },
abstract = {In farm animals, mitochondrial DNA mutations exist widely across breeds and individuals. In order to identify differences among mtDNA haplotypes, two porcine transmitochondrial cybrids were generated by fusion of a Lantang pig cell line devoid of mitochondrial DNA with enucleated cytoplasm from either a Large White pig or a Xiang pig harboring potentially divergent mitochondrial haplotypes. These cybrid cells were subjected to mitochondrial genome sequencing, copy number detecting and analysis of biochemical traits including succinate dehydrogenase (SDH) activity, ATP content and susceptibility to reactive oxygen species (ROS). The Lantang and Xiang mitochondrial genomes were highly homologous with only 18 polymorphic sites, and differed radically from the Large White with 201 and 198 mutations respectively. The Large White and Xiang cybrids exhibited similar mtDNA copy numbers and different values among biochemical traits, generated greater ROS production (P < 0.05) and less SDH activity (P < 0.05) and a lesser ATP content (P < 0.05). The results show that functional differences exist between cybrid cells which differ in mitochondrial genomic background. In conclusion, transmitochondrial cybrids provide the first direct evidence on pig biochemical traits linking different mitochondrial genome haplotypes.},
}

Adenosine Triphosphate/metabolism
Animals
Base Sequence
Cell Line
Genome, Mitochondrial/genetics
Haplotypes/*genetics
Hybrid Cells/*metabolism
Mitochondria/*genetics
Mutation, Missense/genetics
Phylogeny
Reactive Oxygen Species/metabolism
Reproducibility of Results
Succinate Dehydrogenase/metabolism
Sus scrofa/*genetics

@article {pmid26287583,
year = {2016},
author = {Li, G and Li, W and Lv, S and Li, C and Qian, Y and Xu, J and Lu, Y and Lin, Y and Yang, P and Lin, Z and Yang, S},
title = {Identification and phylogenetic analysis of the mitogenome of Sarcocheilichthys parvus Nichols (Cypriniformes: Cyprinidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3542-3543},
doi = {10.3109/19401736.2015.1074209},
pmid = {26287583},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; China ; Cyprinidae/*genetics ; Genes, rRNA ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {In the present study, the complete mitogenome sequence of a Sarcocheilichthys parvus Nichols was sequenced and identified. It contained 22 tRNA genes, 13 protein-coding genes, 2 rRNA genes and 2 non-coding regions. The phylogenetic analysis showed that the mitogenome sequence could be useful data in the field of systematics and conservation biology for S. parvus Nichols and other aquatic species.},
}

Animals
Base Composition
China
Cyprinidae/*genetics
Genes, rRNA
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods

@article {pmid26291784,
year = {2016},
author = {Park, JS and Simpson, AG},
title = {Characterization of a Deep-Branching Heterolobosean, Pharyngomonas turkanaensis n. sp., Isolated from a Non-Hypersaline Habitat, and Ultrastructural Comparison of Cysts and Amoebae Among Pharyngomonas Strains.},
journal = {The Journal of eukaryotic microbiology},
volume = {63},
number = {1},
pages = {100-111},
doi = {10.1111/jeu.12260},
pmid = {26291784},
issn = {1550-7408},
mesh = {Animals ; Eukaryota/*classification/growth & development/isolation & purification/*ultrastructure ; Microscopy, Electron, Transmission ; Mitochondria/ultrastructure ; Phylogeny ; Salinity ; },
abstract = {An unusual heterolobosean amoeba, isolate LO, was isolated recently from a sample with a salinity of ~4‰, from Lake Turkana in East Africa. 18S rDNA phylogenies confirm that isolate LO branches among halophilic amoeboflagellates assigned to Pharyngomonas. We examined the ultrastructure of the amoeba and cyst stages of isolate LO, as well as the amoebae and cysts of Pharyngomonas kirbyi (isolates AS12B and SD1A). The amoebae of all three isolates lacked discrete dictyosomes and had discoidal/flattened mitochondrial cristae, but the mitochondria were not enrobed by rough endoplasmic reticulum. The cysts of all three isolates showed a thick, bipartite cyst wall, and lacked cyst pores. The cysts of isolate LO were distinct in that the ectocyst was very loose-fitting, and could contain "crypts". No flagellate form of isolate LO has been observed to date, and a salinity-for-growth experiment showed that isolate LO can grow at 15-100‰ salinity, indicating that it is halotolerant. By contrast, other studied Pharyngomonas isolates are amoeboflagellates and true halophiles. Therefore, we propose isolate LO as a new species, Pharyngomonas turkanaensis n. sp. It is possible that P. turkanaensis descended from halophilic ancestors, and represents a secondary reestablishment of a physiology adapted for moderate salinity.},
}

Animals
Eukaryota/*classification/growth & development/isolation & purification/*ultrastructure
Microscopy, Electron, Transmission
Mitochondria/ultrastructure
Phylogeny
Salinity

@article {pmid26300379,
year = {2016},
author = {Mai, Q and Li, W and Chen, H and Ai, W and Chen, X},
title = {Complete mitochondrial genome and phylogenetic position of the Sicklefin weasel shark Hemigaleus microstoma.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3491-3492},
doi = {10.3109/19401736.2015.1066363},
pmid = {26300379},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; DNA, Ribosomal/genetics ; Gene Order ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; Sharks/*genetics ; },
abstract = {The complete mitochondrial genome of the Sicklefin weasel shark Hemigaleus microstoma was first presented in this study. It was 16 701 bp in length with the typical gene arrangement in vertebrates. A total of 25 bp short intergenic spaces and 33 bp overlaps located in 12 and 9 gene junctions, respectively. The overall nucleotide composition was 31.0% A, 26.4% C, 13.5% G and 29.1% T. Two start (ATG and GTG) and three stop (TAG, AGG and TAA/T) codons were found in the protein-coding genes. The size of 22 tRNA genes ranged from 67 to 75 bp. In the phylogenetic tree, H. microstoma (Hemigaleidae) was placed as sister to Galeocerdo cuvier (Carcharhinidae).},
}

Animals
Base Composition
DNA, Ribosomal/genetics
Gene Order
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods
Sharks/*genetics

@article {pmid26304849,
year = {2015},
author = {Law, YS and Zhang, R and Guan, X and Cheng, S and Sun, F and Duncan, O and Murcha, MW and Whelan, J and Lim, BL},
title = {Phosphorylation and Dephosphorylation of the Presequence of Precursor MULTIPLE ORGANELLAR RNA EDITING FACTOR3 during Import into Mitochondria from Arabidopsis.},
journal = {Plant physiology},
volume = {169},
number = {2},
pages = {1344-1355},
pmid = {26304849},
issn = {1532-2548},
mesh = {14-3-3 Proteins/metabolism ; Arabidopsis/genetics/*metabolism ; Arabidopsis Proteins/genetics/*metabolism ; HSP70 Heat-Shock Proteins/metabolism ; Mitochondria/*metabolism ; Mitochondrial Proteins/genetics/*metabolism ; Mutation ; Phosphorylation ; Phylogeny ; Plants, Genetically Modified ; Protein Precursors/metabolism ; Protein Serine-Threonine Kinases/metabolism ; Protein Transport ; Transcription Factors/metabolism ; },
abstract = {The nucleus-encoded mitochondria-targeted proteins, multiple organellar RNA editing factors (MORF3, MORF5, and MORF6), interact with Arabidopsis (Arabidopsis thaliana) PURPLE ACID PHOSPHATASE2 (AtPAP2) located on the chloroplast and mitochondrial outer membranes in a presequence-dependent manner. Phosphorylation of the presequence of the precursor MORF3 (pMORF3) by endogenous kinases in wheat germ translation lysate, leaf extracts, or STY kinases, but not in rabbit reticulocyte translation lysate, resulted in the inhibition of protein import into mitochondria. This inhibition of import could be overcome by altering threonine/serine residues to alanine on the presequence, thus preventing phosphorylation. Phosphorylated pMORF3, but not the phosphorylation-deficient pMORF3, can form a complex with 14-3-3 proteins and HEAT SHOCK PROTEIN70. The phosphorylation-deficient mutant of pMORF3 also displayed faster rates of import when translated in wheat germ lysates. Mitochondria isolated from plants with altered amounts of AtPAP2 displayed altered protein import kinetics. The import rate of pMORF3 synthesized in wheat germ translation lysate into pap2 mitochondria was slower than that into wild-type mitochondria, and this rate disparity was not seen for pMORF3 synthesized in rabbit reticulocyte translation lysate, the latter translation lysate largely deficient in kinase activity. Taken together, these results support a role for the phosphorylation and dephosphorylation of pMORF3 during the import into plant mitochondria. These results suggest that kinases, possibly STY kinases, and AtPAP2 are involved in the import of protein into both mitochondria and chloroplasts and provide a mechanism by which the import of proteins into both organelles may be coordinated.},
}

14-3-3 Proteins/metabolism
Arabidopsis/genetics/*metabolism
Arabidopsis Proteins/genetics/*metabolism
HSP70 Heat-Shock Proteins/metabolism
Mitochondria/*metabolism
Mitochondrial Proteins/genetics/*metabolism
Mutation
Phosphorylation
Phylogeny
Plants, Genetically Modified
Protein Precursors/metabolism
Protein Serine-Threonine Kinases/metabolism
Protein Transport
Transcription Factors/metabolism

@article {pmid26305230,
year = {2016},
author = {Su, XH and Zhao, S and Wang, K and Xing, LX},
title = {Complete mitochondrial genome of the "floppy-wing" morph reproductive termite, Reticulitermes labralis (Isoptera: Rhinotermitidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3547-3548},
doi = {10.3109/19401736.2015.1074211},
pmid = {26305230},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Genes, rRNA ; Genome Size ; *Genome, Mitochondrial ; Isoptera/*genetics ; Mitochondria/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {The complete mitochondrial genome of Reticulitermes labralis (Isoptera: Rhinotermitidae) was determined for its nucleotide sequence of 16 113 bp. Its gene content and organization were identical with other Reticulitermes species. The 13 protein-coding genes (PCGs) have typical ATN initiation codon. But, the stop codons were TAA, TAG and an incomplete termination codon (T) abutting an adjacent tRNA gene. Twenty-two tRNA genes, in addition to tRNASer(AGN) replaced lacking of the DHU stem with a simple loop, showed the typical clover-leaf secondary structure. The A + T-rich region was 1311 bp in length with 65.98% A + T content. In addition to the A + T-rich region, non-coding sequences of the mtDNA genome harbored 17 intergenic spacers. There were three complete repeats of repeat A in CR, which were not discovered in other termite species. Phylogenetic tree based on the 11 complete mitochondrial genome sequences of closely related termite species accords well with morphological phylogenetic analysis.},
}

Animals
Base Composition
Genes, rRNA
Genome Size
*Genome, Mitochondrial
Isoptera/*genetics
Mitochondria/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods

@article {pmid26318870,
year = {2015},
author = {Zhong, Z and Norvienyeku, J and Yu, J and Chen, M and Cai, R and Hong, Y and Chen, L and Zhang, D and Wang, B and Zhou, J and Lu, G and Chen, X and Wang, Z},
title = {Two different subcellular-localized Acetoacetyl-CoA acetyltransferases differentiate diverse functions in Magnaporthe oryzae.},
journal = {Fungal genetics and biology : FG & B},
volume = {83},
number = {},
pages = {58-67},
doi = {10.1016/j.fgb.2015.08.008},
pmid = {26318870},
issn = {1096-0937},
mesh = {Acetyl-CoA C-Acetyltransferase/genetics/*metabolism ; Amino Acid Sequence ; Cytoplasm/enzymology ; Gene Deletion ; Gene Expression Regulation, Fungal ; Genes, Fungal ; Homologous Recombination ; Hordeum/microbiology ; Magnaporthe/*enzymology/genetics/pathogenicity ; Mevalonic Acid/metabolism ; Mitochondria/enzymology ; Molecular Sequence Data ; Morphogenesis ; Mutagenesis ; Mutation ; Oryza/microbiology ; Phylogeny ; Plant Diseases/microbiology ; Virulence ; },
abstract = {The mevalonate pathway is an efficient biosynthesis pathway that yields isoprenoids for promoting different crucial cellular functions, including ergosterol synthesis and growth regulation. Acetoacetyl-CoA acetyltransferase (EC2.3.1.9) is the first major catalytic enzyme constituting the mevalonate pathway and catalyzes the transformation of Acetoacetyl-CoA from two molecules of acetyl-CoA enroute ergosterol production in fungi. We identified two homologous genes encoding Acetoacetyl-CoA acetyltransferase (MoAcat1 and MoAcat2) in Magnaporthe oryzae, the rice blast fungus. Phylogenetic analysis indicates these two genes have different evolutionary history. We subsequently, conducted targeted gene deletion using homologous recombination technology to ascertain the unique roles of the two MoAcat homologues during the fungal morphogenesis and pathogenesis. The findings from our investigations showed that the activity of MoAcat1 promoted virulence in the rice blast fungus as such, the ΔMoacat1 mutants generated exhibited defect in virulence, whilst ΔMoacat1 mutants did not portray growth defects. ΔMoacat2 mutants on the other hand were characterized by reduction in growth and virulence. Furthermore, MoAcat1 and MoAcat2 showed different expression patterns and subcellular localizations in M. oryzae. From our investigations we came to the conclusion that, different subcellular localization contributes to the diverse functions of MoAcat1 and MoAcat2, which helps the successful establishment of blast disease by promoting efficient development of cell morphology and effective colonization of host tissue.},
}

Acetyl-CoA C-Acetyltransferase/genetics/*metabolism
Amino Acid Sequence
Cytoplasm/enzymology
Gene Deletion
Gene Expression Regulation, Fungal
Genes, Fungal
Homologous Recombination
Hordeum/microbiology
Magnaporthe/*enzymology/genetics/pathogenicity
Mevalonic Acid/metabolism
Mitochondria/enzymology
Molecular Sequence Data
Morphogenesis
Mutagenesis
Mutation
Oryza/microbiology
Phylogeny
Plant Diseases/microbiology
Virulence

@article {pmid26321226,
year = {2016},
author = {Ojanguren-Affilastro, AA and Mattoni, CI and Ochoa, JA and Ramírez, MJ and Ceccarelli, FS and Prendini, L},
title = {Phylogeny, species delimitation and convergence in the South American bothriurid scorpion genus Brachistosternus Pocock 1893: Integrating morphology, nuclear and mitochondrial DNA.},
journal = {Molecular phylogenetics and evolution},
volume = {94},
number = {Pt A},
pages = {159-170},
doi = {10.1016/j.ympev.2015.08.007},
pmid = {26321226},
issn = {1095-9513},
mesh = {Acclimatization ; Altitude ; Animals ; Base Sequence ; Bayes Theorem ; Cell Nucleus/*genetics ; DNA, Mitochondrial/*genetics ; DNA, Ribosomal/genetics ; Desert Climate ; Electron Transport Complex IV/genetics ; *Genetic Speciation ; Likelihood Functions ; Male ; Mitochondria/genetics ; *Phylogeny ; Scorpions/*anatomy & histology/*genetics ; South America ; },
abstract = {A phylogenetic analysis of the scorpion genus Brachistosternus Pocock, 1893 (Bothriuridae Simon, 1880) is presented, based on a dataset including 41 of the 43 described species and five outgroups, 116 morphological characters and more than 4150 base-pairs of DNA sequence from the nuclear 18S rDNA and 28S rDNA gene loci, and the mitochondrial 12S rDNA, 16S rDNA, and Cytochrome c Oxidase Subunit I gene loci. Analyses conducted using parsimony, Maximum Likelihood and Bayesian Inference were largely congruent with high support for most clades. The results confirmed the monophyly of Brachistosternus, the nominal subgenus, and subgenus Ministernus Francke, 1985, as in previous analyses based only on morphology, but differed in several other respects. Species from the plains of the Atacama Desert diverged basally whereas the high altitude Andean species radiated from a more derived ancestor, presumably as a consequence of Andean uplift and associated changes in climate. Species limits were assessed among species that contain intraspecific variation (e.g., different morphs), are difficult to separate morphologically, and/or exhibit widespread or disjunct distributions. The extent of convergence in morphological adaptation to life on sandy substrata (psammophily) and the complexity of the male genitalia, or hemispermatophores, was investigated. Psammophily evolved on at least four independent occasions. The lobe regions of the hemispermatophore increased in complexity on three independent occasions, and decreased in complexity on another three independent occasions.},
}

Acclimatization
Altitude
Animals
Base Sequence
Bayes Theorem
Cell Nucleus/*genetics
DNA, Mitochondrial/*genetics
DNA, Ribosomal/genetics
Desert Climate
Electron Transport Complex IV/genetics
*Genetic Speciation
Likelihood Functions
Male
Mitochondria/genetics
*Phylogeny
Scorpions/*anatomy & histology/*genetics
South America

@article {pmid26330004,
year = {2016},
author = {Bo, Z and Wenping, S and Kefeng, L and Debin, Z and Chao, M and Guangxia, X},
title = {The complete mitochondrial genome of Cleithenes herzenstein and its phylogenetic analysis.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3663-3665},
doi = {10.3109/19401736.2015.1079845},
pmid = {26330004},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Base Sequence ; DNA, Mitochondrial/genetics ; Fishes/*genetics ; Gene Order ; Genes, Mitochondrial ; Genome Size ; *Genome, Mitochondrial ; Phylogeny ; RNA, Ribosomal/genetics ; RNA, Transfer/genetics ; Whole Genome Sequencing ; },
abstract = {The complete mitochondrial genome of Stewartia sinensis was obtained with long PCR approach. Amplification primers were designed according to mitogenome sequences of some other fish species. PCR reactions were according to Kong et al. (2009). The complete mitochondria sequence of Cleithenes herzenstein was deposited in GenBank under the accession number KT223828. Structural and evolutionary analyses were also performed. The length of the complete mitochondrial DNA sequence was 17 175 bp, consisting of 13 protein-coding genes, 22 tRNA genes, and two rRNA genes. Other than D-loop, another non-coding region named ''OL'' region was found (Table 1). The ''OL'' region (CTTTTTCCCGCCTAGTTTAACCAGTAAAAGGCGGGAA) is 38 bp and has the potential to fold into a stem-loop secondary structure. Most of the genes were encoded on the heavy strand (H strand) except for ND6 and eight tRNA genes (Table 1). The base composition and gene arrangement of C. herzenstein mitogenome was identical to typical vertebrate. For sequence alignment, the mitogenome sequence of C. herzenstein was 96% and 95% similar to that of Platichthys stellatus and Verasper moseri, respectively.},
}

Animals
Base Composition
Base Sequence
DNA, Mitochondrial/genetics
Fishes/*genetics
Gene Order
Genes, Mitochondrial
Genome Size
*Genome, Mitochondrial
Phylogeny
RNA, Ribosomal/genetics
RNA, Transfer/genetics
Whole Genome Sequencing

@article {pmid26330185,
year = {2016},
author = {Ren, J and Pu, J and Buchinger, T and Zhu, X and Baker, C and Li, W},
title = {The mitogenomes of the pouched lamprey (Geotria australis) and least brook lamprey (Lampetra aepyptera) with phylogenetic considerations.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3560-3562},
doi = {10.3109/19401736.2015.1074218},
pmid = {26330185},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Gene Dosage ; Gene Order ; Genes, rRNA ; Genome Size ; *Genome, Mitochondrial ; Lampreys/*classification/genetics ; Mitochondria/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {We report the mitogenomes of the pouched lamprey (Geotria australis) and least brook lamprey (Lampetra aepyptera) in the families Geotriidae and Petromyzontidae, respectively. Both of the mitogenomes contain the 37 typical vertebrate genes. Their gene order and contents are identical to those of previously described lamprey mitogenomes. The mitogenome of G. australis (17 080 bp) is the largest among the 10 reported lamprey mitogenomes, owed to two long noncoding regions. The mitogenome of L. aepyptera is 77 bp longer (16 236 bp) than that of the congeneric European river lamprey L. fluviatilis, a size difference mostly due to different copy numbers of tandem repeats in the noncoding regions. The phylogenetic analysis supports that the pouched lamprey (Geotriidae) diverged earlier from the common ancestor of lampreys than the Petromyzonids, and the placement of the least brook lamprey in the genus Lampetra.},
}

Animals
Base Composition
Gene Dosage
Gene Order
Genes, rRNA
Genome Size
*Genome, Mitochondrial
Lampreys/*classification/genetics
Mitochondria/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods

@article {pmid26334392,
year = {2015},
author = {Zeng, X and Cheng, N and Zheng, X and Diao, Y and Fang, G and Jin, S and Zhou, F and Hu, Z},
title = {Molecular cloning and characterization of two manganese superoxide dismutases from Miscanthus × giganteus.},
journal = {Plant cell reports},
volume = {34},
number = {12},
pages = {2137-2149},
pmid = {26334392},
issn = {1432-203X},
mesh = {Amino Acid Sequence ; Antioxidants/metabolism ; Base Sequence ; Cloning, Molecular ; Mitochondria/enzymology ; Molecular Sequence Data ; Phylogeny ; Plant Proteins/*genetics/metabolism ; Poaceae/*enzymology/genetics ; Sequence Analysis, DNA ; Superoxide Dismutase/*genetics/metabolism ; },
abstract = {Six MnSOD genes were isolated from five Miscanthus species. MgMnSOD1 functions in mitochondria and MgMnSOD1 seems to be the main MnSOD gene involved in stress response of M. × giganteus. Miscanthus × giganteus is a promising biomass energy crop with advantages of vigorous growth, high yield, low fertilizer and pesticide inputs. However, poor overwinter ability limits its widespread cultivation. Moreover, narrow genetic base may increase the risk of susceptibility to diseases and pests. Manganese superoxide dismutase (MnSOD), an important antioxidant enzyme involved in stress tolerance is able to protect plant cells from accumulated reactive oxygen species by converting superoxide to peroxide and oxygen. In many plants, overexpression of MnSOD has shown the ability to enhance the resistance to various stresses. This article describes the studies performed in an attempt to elucidate the molecular and enzymatic properties of MnSODs in M. × giganteus. MnSOD genes from M. × giganteus (MgMnSOD1, MgMnSOD2), M. lutarioriparia (MlMnSOD), M. sacchariflora (MsaMnSOD), M. sinensis (MsiMnSOD), and M. floridulus (MfMnSOD) were cloned and sequenced. The sequence analysis and expression patterns of MgMnSOD1 and MgMnSOD2 suggest that they were orthologous genes which were inherited from the two parents, M. sacchariflora and M. sinensis, respectively. In addition, MgMnSOD1 is predicted to be the main MnSOD gene involved in stress response of M. × giganteus. The activity of purified recombinant MgMnSOD1 was 1854.79 ± 39.98 U mg(-1) (mean ± SD). Further enzymatic assays revealed that the protein exhibited an outstanding thermal stability. MgMnSOD1 is predicted to be targeted to mitochondria and involved in removing the superoxide radical generated by respiration. The presence and sequences of other SOD isozymes transcripts were also investigated in this study.},
}

Amino Acid Sequence
Antioxidants/metabolism
Base Sequence
Cloning, Molecular
Mitochondria/enzymology
Molecular Sequence Data
Phylogeny
Plant Proteins/*genetics/metabolism
Poaceae/*enzymology/genetics
Sequence Analysis, DNA
Superoxide Dismutase/*genetics/metabolism

@article {pmid26336091,
year = {2015},
author = {Bosacchi, M and Gurdon, C and Maliga, P},
title = {Plastid Genotyping Reveals the Uniformity of Cytoplasmic Male Sterile-T Maize Cytoplasms.},
journal = {Plant physiology},
volume = {169},
number = {3},
pages = {2129-2137},
pmid = {26336091},
issn = {1532-2548},
mesh = {Cytoplasm/genetics ; *Genetic Variation ; Genome, Mitochondrial/*genetics ; Genome, Plastid/genetics ; Genotype ; Genotyping Techniques ; Mitochondria/genetics ; Phylogeny ; Plant Infertility/*genetics ; Plastids/genetics/metabolism ; Pollen/genetics/physiology ; Sequence Analysis, DNA ; Zea mays/*genetics/physiology ; },
abstract = {Cytoplasmic male-sterile (CMS) lines in maize (Zea mays) have been classified by their response to specific restorer genes into three categories: cms-C, cms-S, and cms-T. A mitochondrial genome representing each of the CMS cytotypes has been sequenced, and male sterility in the cms-S and cms-T cytotypes is linked to chimeric mitochondrial genes. To identify markers for plastid genotyping, we sequenced the plastid genomes of three fertile maize lines (B37, B73, and A188) and the B37 cms-C, cms-S, and cms-T cytoplasmic substitution lines. We found that the plastid genomes of B37 and B73 lines are identical. Furthermore, the fertile and CMS plastid genomes are conserved, differing only by zero to three single-nucleotide polymorphisms (SNPs) in coding regions and by eight to 22 SNPs and 10 to 21 short insertions/deletions in noncoding regions. To gain insight into the origin and transmission of the cms-T trait, we identified three SNPs unique to the cms-T plastids and tested the three diagnostic SNPs in 27 cms-T lines, representing the HA, I, Q, RS, and T male-sterile cytoplasms. We report that each of the tested 27 cms-T group accessions have the same three diagnostic plastid SNPs, indicating a single origin and maternal cotransmission of the cms-T mitochondria and plastids to the seed progeny. Our data exclude exceptional pollen transmission of organelles or multiple horizontal gene transfer events as the source of the mitochondrial urf13-T (unidentified reading frame encoding 13-kD cms-T protein) gene in the cms-T cytoplasms. Plastid genotyping enables a reassessment of the evolutionary relationships of cytoplasms in cultivated maize.},
}

Cytoplasm/genetics
*Genetic Variation
Genome, Mitochondrial/*genetics
Genome, Plastid/genetics
Genotype
Genotyping Techniques
Mitochondria/genetics
Phylogeny
Plant Infertility/*genetics
Plastids/genetics/metabolism
Pollen/genetics/physiology
Sequence Analysis, DNA
Zea mays/*genetics/physiology

@article {pmid26365128,
year = {2016},
author = {Wei, H and Jia, Q and Chen, G and Chen, S},
title = {The complete mitogenome of lesser striped shrew Sorex bedfordiae (soricidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4290-4291},
doi = {10.3109/19401736.2015.1082100},
pmid = {26365128},
issn = {2470-1408},
mesh = {Animals ; Base Composition/genetics ; Base Sequence/genetics ; Conserved Sequence/genetics ; DNA, Mitochondrial/*genetics ; Gene Order/genetics ; Genes, Mitochondrial/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/genetics ; Phylogeny ; Sequence Analysis, DNA/methods ; Shrews/*genetics ; },
abstract = {The Sorex genus is type genus in Soricidae. Most of them lack comprehensive biological data. In this study, the complete mitochondrial genome sequence of Sorex bedfordiae was determined. The mitogenome is 17 160 base pairs in length and contains 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and one control region. The nucleotide sequence data of 12 heavy-strand protein-coding genes of Sorex bedfordiae and other 10 species in Soricidae were used for phylogenetic analyses. Tree constructed using Bayesian phylogenetic methods demonstrated Sorex bedfordiae as a sister to Sorex cylindricauda. Phylogenetic analyses further confirmed that Blarinella diverged prior to Sorex and Anourosorex, but Episoriculus differentiated earlier than Neomys and Nectogale within subfamily Soricinae.},
}

Animals
Base Composition/genetics
Base Sequence/genetics
Conserved Sequence/genetics
DNA, Mitochondrial/*genetics
Gene Order/genetics
Genes, Mitochondrial/genetics
Genome, Mitochondrial/*genetics
Mitochondria/genetics
Phylogeny
Sequence Analysis, DNA/methods
Shrews/*genetics

@article {pmid26367084,
year = {2016},
author = {López, K and Angeli, C and Aguilar, C and Loaiza, JR and De León, LF and McMillan, WO and Miller, MJ},
title = {Extreme mitogenomic divergence between two syntopic specimens of Arremon aurantiirostris (Aves: Emberizidae) in central Panama suggests possible cryptic species.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3451-3453},
doi = {10.3109/19401736.2015.1066344},
pmid = {26367084},
issn = {2470-1408},
mesh = {Animals ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; NADH Dehydrogenase/genetics ; Panama ; Phylogeny ; Sequence Analysis, DNA/*methods ; Sparrows/classification/*genetics ; Species Specificity ; },
abstract = {We report the complete mitochondrial genome of two specimens of Orange-billed Sparrow Arremon aurantiirostris from Colón Province, in central Panama. The two specimens were collected on the same day, and at the same locality; however, they showed substantial divergence (6.3% average pairwise divergence among coding genes). A survey of ND2 sequence variation across Panama suggests that this divergence is the result of geographic differentiation and secondary contact. This high level of mitochondrial divergence among co-occurring individuals raises the possibility of multiple biological species in Orange-billed Sparrows. Our results are yet another demonstration that much remains to be discovered regarding avian biodiversity in Panama and throughout the Neotropics.},
}

Animals
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
NADH Dehydrogenase/genetics
Panama
Phylogeny
Sequence Analysis, DNA/*methods
Sparrows/classification/*genetics
Species Specificity

@article {pmid26381927,
year = {2015},
author = {Sheiner, L and Fellows, JD and Ovciarikova, J and Brooks, CF and Agrawal, S and Holmes, ZC and Bietz, I and Flinner, N and Heiny, S and Mirus, O and Przyborski, JM and Striepen, B},
title = {Toxoplasma gondii Toc75 Functions in Import of Stromal but not Peripheral Apicoplast Proteins.},
journal = {Traffic (Copenhagen, Denmark)},
volume = {16},
number = {12},
pages = {1254-1269},
doi = {10.1111/tra.12333},
pmid = {26381927},
issn = {1600-0854},
support = {104111//Wellcome Trust/United Kingdom ; K99 AI103032/AI/NIAID NIH HHS/United States ; R01 AI064671/AI/NIAID NIH HHS/United States ; R01 AI084415/AI/NIAID NIH HHS/United States ; },
mesh = {Apicomplexa/genetics/metabolism ; Apicoplasts/genetics/*metabolism ; Erythrocytes/parasitology ; Fibroblasts/parasitology ; Green Fluorescent Proteins ; Humans ; Intracellular Membranes/*metabolism ; Membrane Proteins/genetics/*metabolism ; Microscopy, Fluorescence ; Mitochondria/metabolism ; Mutagenesis, Site-Directed ; Phenylalanine/genetics ; Phylogeny ; Protein Transport ; Protozoan Proteins/genetics/*metabolism ; Toxoplasma/genetics/*metabolism ; },
abstract = {Apicomplexa are unicellular parasites causing important human and animal diseases, including malaria and toxoplasmosis. Most of these pathogens possess a relict but essential plastid, the apicoplast. The apicoplast was acquired by secondary endosymbiosis between a red alga and a flagellated eukaryotic protist. As a result the apicoplast is surrounded by four membranes. This complex structure necessitates a system of transport signals and translocons allowing nuclear encoded proteins to find their way to specific apicoplast sub-compartments. Previous studies identified translocons traversing two of the four apicoplast membranes. Here we provide functional support for the role of an apicomplexan Toc75 homolog in apicoplast protein transport. We identify two apicomplexan genes encoding Toc75 and Sam50, both members of the Omp85 protein family. We localize the respective proteins to the apicoplast and the mitochondrion of Toxoplasma and Plasmodium. We show that the Toxoplasma Toc75 is essential for parasite growth and that its depletion results in a rapid defect in the import of apicoplast stromal proteins while the import of proteins of the outer compartments is affected only as the secondary consequence of organelle loss. These observations along with the homology to Toc75 suggest a potential role in transport through the second innermost membrane.},
}

Apicomplexa/genetics/metabolism
Apicoplasts/genetics/*metabolism
Erythrocytes/parasitology
Fibroblasts/parasitology
Green Fluorescent Proteins
Humans
Intracellular Membranes/*metabolism
Membrane Proteins/genetics/*metabolism
Microscopy, Fluorescence
Mitochondria/metabolism
Mutagenesis, Site-Directed
Phenylalanine/genetics
Phylogeny
Protein Transport
Protozoan Proteins/genetics/*metabolism
Toxoplasma/genetics/*metabolism

@article {pmid26384251,
year = {2016},
author = {Jin, JM and Hou, CC and Tan, FQ and Yang, WX},
title = {The potential function of prohibitin during spermatogenesis in Chinese fire-bellied newt Cynops orientalis.},
journal = {Cell and tissue research},
volume = {363},
number = {3},
pages = {805-822},
doi = {10.1007/s00441-015-2280-y},
pmid = {26384251},
issn = {1432-0878},
mesh = {Amino Acid Sequence ; Animals ; Base Sequence ; Blotting, Western ; Cloning, Molecular ; DNA, Complementary/genetics ; Fluorescent Antibody Technique ; Gene Expression Regulation ; In Situ Hybridization ; Male ; Mitochondria/metabolism ; Molecular Sequence Data ; Phylogeny ; Prohibitins ; RNA, Messenger/genetics/metabolism ; Repressor Proteins/genetics/*metabolism ; Salamandridae/genetics/*physiology ; Sequence Alignment ; Sertoli Cells/cytology/metabolism ; *Spermatogenesis/genetics ; Spermatozoa/cytology/metabolism ; Staining and Labeling ; Time Factors ; },
abstract = {Prohibitin proteins are multifunctional proteins located mainly at the inner membrane of mitochondria expressed in universal species. They play a vital role in mitochondria's function, cell proteolysis, senescence, apoptosis and as a substrate for ubiquitination. In this study, we used PCR cloning, protein and nucleotide acids alignment, protein structure prediction, western blot, in situ hybridization and immunofluorescence to study the characteristics of the prohibitin gene and the potential role of prohibitin in spermatogenesis and spermiogenesis processes in the Chinese fire-bellied newt Cynops orientalis. First, we cloned a 1452-bp full-length cDNA from the testis of Cynops orientalis. Second, we found that the 272 amino acids of prohibitin have a SPFH family domain. Thirdly, the western blots showed high expression of prohibitin in testis while the protein size was approximately 32 kDa. Fourthly, the results of in situ hybridization and immunofluorescence experiments showed that most of the prohibitins travelled with the mitochondria's migration in Cynops orientalis. The quantities of mRNA decreased as spermiogenesis proceeded, although the signals of prohibitins existed during the whole period of spermatogenesis and spermiogenesis. In the mature germ cells, the signals of prohibitins were weak and aggregated at the end of the cell. Finally, we discovered that the Sertoli cells had a large quantity of prohibitins and we made several assumptions of prohibitins' potential roles in those cells. This is the first time that the relationship between mitochondria and prohibitin in different stages of the sperm cells in Cynops orientalis has been examined, which also revealed that Sertoli cells have abundant prohibitins.},
}

Amino Acid Sequence
Animals
Base Sequence
Blotting, Western
Cloning, Molecular
DNA, Complementary/genetics
Fluorescent Antibody Technique
Gene Expression Regulation
In Situ Hybridization
Male
Mitochondria/metabolism
Molecular Sequence Data
Phylogeny
Prohibitins
RNA, Messenger/genetics/metabolism
Repressor Proteins/genetics/*metabolism
Salamandridae/genetics/*physiology
Sequence Alignment
Sertoli Cells/cytology/metabolism
*Spermatogenesis/genetics
Spermatozoa/cytology/metabolism
Staining and Labeling
Time Factors

@article {pmid26402847,
year = {2015},
author = {Guan, X and Chen, H and Abramson, A and Man, H and Wu, J and Yu, O and Nikolau, BJ},
title = {A phosphopantetheinyl transferase that is essential for mitochondrial fatty acid biosynthesis.},
journal = {The Plant journal : for cell and molecular biology},
volume = {84},
number = {4},
pages = {718-732},
doi = {10.1111/tpj.13034},
pmid = {26402847},
issn = {1365-313X},
mesh = {Amino Acid Sequence ; Arabidopsis/genetics/growth & development/metabolism ; Arabidopsis Proteins/genetics/*metabolism ; Bacterial Proteins/classification/genetics/*metabolism ; Blotting, Western ; Fatty Acids/*biosynthesis ; Gene Expression Regulation, Developmental ; Gene Expression Regulation, Plant ; Glycine/metabolism ; Glycolates/metabolism ; Green Fluorescent Proteins/genetics/metabolism ; Microscopy, Confocal ; Mitochondria/genetics/*metabolism ; Mitochondrial Proteins/genetics/*metabolism ; Molecular Sequence Data ; Mutation ; Phylogeny ; Plants, Genetically Modified ; RNA Interference ; Reverse Transcriptase Polymerase Chain Reaction ; Seeds/genetics/growth & development/metabolism ; Sequence Homology, Amino Acid ; Transferases (Other Substituted Phosphate Groups)/classification/genetics/*metabolism ; },
abstract = {In this study we report the molecular genetic characterization of the Arabidopsis mitochondrial phosphopantetheinyl transferase (mtPPT), which catalyzes the phosphopantetheinylation and thus activation of mitochondrial acyl carrier protein (mtACP) of mitochondrial fatty acid synthase (mtFAS). This catalytic capability of the purified mtPPT protein (encoded by AT3G11470) was directly demonstrated in an in vitro assay that phosphopantetheinylated mature Arabidopsis apo-mtACP isoforms. The mitochondrial localization of the AT3G11470-encoded proteins was validated by the ability of their N-terminal 80-residue leader sequence to guide a chimeric GFP protein to this organelle. A T-DNA-tagged null mutant mtppt-1 allele shows an embryo-lethal phenotype, illustrating a crucial role of mtPPT for embryogenesis. Arabidopsis RNAi transgenic lines with reduced mtPPT expression display typical phenotypes associated with a deficiency in the mtFAS system, namely miniaturized plant morphology, slow growth, reduced lipoylation of mitochondrial proteins, and the hyperaccumulation of photorespiratory intermediates, glycine and glycolate. These morphological and metabolic alterations are reversed when these plants are grown in a non-photorespiratory condition (i.e. 1% CO2 atmosphere), demonstrating that they are a consequence of a deficiency in photorespiration due to the reduced lipoylation of the photorespiratory glycine decarboxylase.},
}

Amino Acid Sequence
Arabidopsis/genetics/growth & development/metabolism
Arabidopsis Proteins/genetics/*metabolism
Bacterial Proteins/classification/genetics/*metabolism
Blotting, Western
Fatty Acids/*biosynthesis
Gene Expression Regulation, Developmental
Gene Expression Regulation, Plant
Glycine/metabolism
Glycolates/metabolism
Green Fluorescent Proteins/genetics/metabolism
Microscopy, Confocal
Mitochondria/genetics/*metabolism
Mitochondrial Proteins/genetics/*metabolism
Molecular Sequence Data
Mutation
Phylogeny
Plants, Genetically Modified
RNA Interference
Reverse Transcriptase Polymerase Chain Reaction
Seeds/genetics/growth & development/metabolism
Sequence Homology, Amino Acid
Transferases (Other Substituted Phosphate Groups)/classification/genetics/*metabolism

@article {pmid26404517,
year = {2016},
author = {Zhao, M and Ma, H and Ma, C and Zhang, H and Zhang, X and Meng, Y and Wei, H and Chen, F and Ma, L},
title = {The complete mitochondrial genome and gene organization of Cubiceps squamiceps (Perciformes: nomeidae) with phylogenetic consideration.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4296-4297},
doi = {10.3109/19401736.2015.1082103},
pmid = {26404517},
issn = {2470-1408},
mesh = {Animals ; Base Composition/genetics ; Base Sequence/genetics ; Conserved Sequence/genetics ; DNA, Mitochondrial/*genetics ; Fishes/genetics ; Gene Order/genetics ; Genes, Mitochondrial/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/genetics ; Perciformes/*genetics ; Phylogeny ; Sequence Analysis, DNA/methods ; },
abstract = {In this study, we reported the complete mitochondrial DNA sequence of Cubiceps squamiceps, and its phylogenetic relationship. The full length of this mitogenome was 16 510 bp, including 22 transfer RNA genes, two ribosomal RNA genes, 13 protein-coding genes, and a putative control region. The location of genes in mitochondrial genome was similar to other fish species within family Nomeidae. Twenty-eight genes were located on the heavy strand, while nine genes were located on the light strand. The nucleotide composition of this mitogenome was 27.5% for A, 28.5% for C, 17.5% for G, and 26.5% for T. From the NJ phylogenetic tree, we can find that C. squamiceps was genetically closest to C. pauciradiatus among 20 species within suborder Stromateoidei. This study could lay the basis for the future studies in population genetic diversity, taxonomic status, molecular systematics, and conservation genetics in C. squamiceps.},
}

Animals
Base Composition/genetics
Base Sequence/genetics
Conserved Sequence/genetics
DNA, Mitochondrial/*genetics
Fishes/genetics
Gene Order/genetics
Genes, Mitochondrial/genetics
Genome, Mitochondrial/*genetics
Mitochondria/genetics
Perciformes/*genetics
Phylogeny
Sequence Analysis, DNA/methods

@article {pmid26406120,
year = {2016},
author = {Guan, N and Nie, C and Geng, R and Gao, Z and Zhang, X},
title = {The complete mitochondrial genome of the hybrid of Megalobrama amblycephala (♀) × Megalobrama skolkovii (♂).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4294-4295},
doi = {10.3109/19401736.2015.1082102},
pmid = {26406120},
issn = {2470-1408},
mesh = {Animals ; Base Composition/genetics ; Base Sequence/genetics ; Chimera/genetics ; Conserved Sequence/genetics ; Cyprinidae/*genetics ; DNA, Mitochondrial/*genetics ; Gene Order/genetics ; Genes, Mitochondrial/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/genetics ; Phylogeny ; Sequence Analysis, DNA/methods ; },
abstract = {The complete mitochondrial genome of the hybrid of Megalobrama amblycephala (♀) × Megalobrama skolkovii (♂) was characterized first in this study. The total length of the genome was identical to the female parent as 16 623 bp, and the overall base composition was 31.23% A, 24.69% T, 27.89% C, and 16.19% G, with a slight A + T bias. It contained 13 protein-coding genes (PCGs), 22 transfer RNA genes, 2 ribosomal RNA genes, and 2 main non-coding regions (the control region and the origin of the light-strand replication). This study discovered the 99.88% sequence identity between the hybrid and its female parent, which confirmed the maternal inheritance pattern followed by the mitochondrial genome of the hybrid. However, the sequence alignment of mitochondrial genomes between the hybrid and its female parent revealed a total of 20 variable sites in 10 genes or regions, especially 4 sense mutations in 2 PCGs (COX1 and ATPase6). The complete mitochondrial genome sequence of this hybrid bream may provide an important dataset for further study in mitochondrial inheritance mechanism.},
}

Animals
Base Composition/genetics
Base Sequence/genetics
Chimera/genetics
Conserved Sequence/genetics
Cyprinidae/*genetics
DNA, Mitochondrial/*genetics
Gene Order/genetics
Genes, Mitochondrial/genetics
Genome, Mitochondrial/*genetics
Mitochondria/genetics
Phylogeny
Sequence Analysis, DNA/methods

@article {pmid26406276,
year = {2016},
author = {Yao, H and Gao, M and Liu, K and Zhao, S},
title = {Sequence characterization and phylogeny analysis of the complete mitochondrial genome of verreaux's sifaka, Propithecus verreauxi (primates: indriidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4431-4432},
doi = {10.3109/19401736.2015.1089558},
pmid = {26406276},
issn = {2470-1408},
mesh = {Animals ; Base Composition/genetics ; Codon, Initiator/genetics ; Codon, Terminator/genetics ; Gene Order/genetics ; Genes, rRNA/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/*genetics ; Phylogeny ; Primates/*genetics ; RNA, Transfer/genetics ; Sequence Analysis, DNA/methods ; Strepsirhini/*genetics ; },
abstract = {The Verreaux's sifaka, Propithecus verreauxi, is a medium-sized lemur that inhabits in tropical dry lowland and montane forest. Here, we reported the complete mitochondrial genome sequence of this species. The mitogenome of P. verreauxi is 17 106 bp in length and composed of 13 protein-coding genes (PCGs), 2 ribosomal RNA genes, 22 transfer RNA genes and a control region. The structure about gene order and composition is identical to that of the other lemur species and related genera. The overall base composition of the heavy strand in descending order is A (32.84%), T (27.13%), C (26.95%), and G (13.08%). Most of the genes are encoded on the heavy strand except for the NADH dehydrogenase subunit 6 (ND6) and eight tRNA genes. With the exception of COX3, which terminates with an incomplete stop codon (T-), all the other PCGs initiates with a traditional ATN start codon and ends with the typical mitochondrial stop codon (TAG/TAA/AGA). The phylogenetic tree constructed using the complete mitochondrial genome sequences of P. verreauxi together with 15 other closely related species with Neighbor-Joining (NJ) method shows that P. verreauxi is closer to P. coquereli in the phylogenetic relationship.},
}

Animals
Base Composition/genetics
Codon, Initiator/genetics
Codon, Terminator/genetics
Gene Order/genetics
Genes, rRNA/genetics
Genome, Mitochondrial/*genetics
Mitochondria/*genetics
Phylogeny
Primates/*genetics
RNA, Transfer/genetics
Sequence Analysis, DNA/methods
Strepsirhini/*genetics

@article {pmid26419670,
year = {2015},
author = {Nishimura, K and Apitz, J and Friso, G and Kim, J and Ponnala, L and Grimm, B and van Wijk, KJ},
title = {Discovery of a Unique Clp Component, ClpF, in Chloroplasts: A Proposed Binary ClpF-ClpS1 Adaptor Complex Functions in Substrate Recognition and Delivery.},
journal = {The Plant cell},
volume = {27},
number = {10},
pages = {2677-2691},
pmid = {26419670},
issn = {1532-298X},
mesh = {Adaptor Proteins, Signal Transducing/genetics/*metabolism ; Aldehyde Oxidoreductases/genetics/metabolism ; Arabidopsis/*enzymology/genetics ; Arabidopsis Proteins/genetics/*metabolism ; Carrier Proteins/genetics/*metabolism ; Chloroplasts/enzymology ; Endopeptidase Clp/genetics/*metabolism ; *Models, Molecular ; Molecular Chaperones/genetics/metabolism ; Multienzyme Complexes ; Mutation ; Phylogeny ; Protein Interaction Mapping ; *Proteome ; Sequence Analysis, DNA ; Substrate Specificity ; },
abstract = {Clp proteases are found in prokaryotes, mitochondria, and plastids where they play crucial roles in maintaining protein homeostasis (proteostasis). The plant plastid Clp machinery comprises a hetero-oligomeric ClpPRT proteolytic core, ATP-dependent chaperones ClpC and ClpD, and an adaptor protein, ClpS1. ClpS1 selects substrates to the ClpPR protease-ClpC chaperone complex for degradation, but the underlying substrate recognition and delivery mechanisms are currently unclear. Here, we characterize a ClpS1-interacting protein in Arabidopsis thaliana, ClpF, which can interact with the Clp substrate glutamyl-tRNA reductase. ClpF and ClpS1 mutually stimulate their association with ClpC. ClpF, which is only found in photosynthetic eukaryotes, contains bacterial uvrB/C and YccV protein domains and a unique N-terminal domain. We propose a testable model in which ClpS1 and ClpF form a binary adaptor for selective substrate recognition and delivery to ClpC, reflecting an evolutionary adaptation of the Clp system to the plastid proteome.},
}

Adaptor Proteins, Signal Transducing/genetics/*metabolism
Aldehyde Oxidoreductases/genetics/metabolism
Arabidopsis/*enzymology/genetics
Arabidopsis Proteins/genetics/*metabolism
Carrier Proteins/genetics/*metabolism
Chloroplasts/enzymology
Endopeptidase Clp/genetics/*metabolism
*Models, Molecular
Molecular Chaperones/genetics/metabolism
Multienzyme Complexes
Mutation
Phylogeny
Protein Interaction Mapping
*Proteome
Sequence Analysis, DNA
Substrate Specificity

@article {pmid26435002,
year = {2016},
author = {Manna, S and Harman, A},
title = {Horizontal gene transfer of a Chlamydial tRNA-guanine transglycosylase gene to eukaryotic microbes.},
journal = {Molecular phylogenetics and evolution},
volume = {94},
number = {Pt A},
pages = {392-396},
doi = {10.1016/j.ympev.2015.09.022},
pmid = {26435002},
issn = {1095-9513},
mesh = {Acanthamoeba/*genetics ; Amebiasis/genetics/parasitology ; Chlamydia/enzymology/*genetics ; Deltaproteobacteria/enzymology/genetics ; Dysentery, Bacillary/microbiology ; Eukaryota/genetics ; *Gene Transfer, Horizontal ; Pentosyltransferases/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Shigella flexneri/enzymology/genetics ; },
abstract = {tRNA-guanine transglycosylases are found in all domains of life and mediate the base exchange of guanine with queuine in the anticodon loop of tRNAs. They can also regulate virulence in bacteria such as Shigella flexneri, which has prompted the development of drugs that inhibit the function of these enzymes. Here we report a group of tRNA-guanine transglycosylases in eukaryotic microbes (algae and protozoa) which are more similar to their bacterial counterparts than previously characterized eukaryotic tRNA-guanine transglycosylases. We provide evidence demonstrating that the genes encoding these enzymes were acquired by these eukaryotic lineages via horizontal gene transfer from the Chlamydiae group of bacteria. Given that the S. flexneri tRNA-guanine transglycosylase can be targeted by drugs, we propose that the bacterial-like tRNA-guanine transglycosylases could potentially be targeted in a similar fashion in pathogenic amoebae that possess these enzymes such as Acanthamoeba castellanii. This work also presents ancient prokaryote-to-eukaryote horizontal gene transfer events as an untapped resource of potential drug target identification in pathogenic eukaryotes.},
}

Acanthamoeba/*genetics
Amebiasis/genetics/parasitology
Chlamydia/enzymology/*genetics
Deltaproteobacteria/enzymology/genetics
Dysentery, Bacillary/microbiology
Eukaryota/genetics
*Gene Transfer, Horizontal
Pentosyltransferases/*genetics
Phylogeny
RNA, Transfer/genetics
Shigella flexneri/enzymology/genetics

@article {pmid26436880,
year = {2015},
author = {Noguchi, F and Shimamura, S and Nakayama, T and Yazaki, E and Yabuki, A and Hashimoto, T and Inagaki, Y and Fujikura, K and Takishita, K},
title = {Metabolic Capacity of Mitochondrion-related Organelles in the Free-living Anaerobic Stramenopile Cantina marsupialis.},
journal = {Protist},
volume = {166},
number = {5},
pages = {534-550},
doi = {10.1016/j.protis.2015.08.002},
pmid = {26436880},
issn = {1618-0941},
mesh = {Mitochondria/*metabolism ; Phylogeny ; Sequence Analysis, RNA ; Stramenopiles/genetics/*metabolism ; },
abstract = {Functionally and morphologically degenerate mitochondria, so-called mitochondrion-related organelles (MROs), are frequently found in eukaryotes inhabiting hypoxic or anoxic environments. In the last decade, MROs have been discovered from a phylogenetically broad range of eukaryotic lineages and these organelles have been revealed to possess diverse metabolic capacities. In this study, the biochemical characteristics of an MRO in the free-living anaerobic protist Cantina marsupialis, which represents an independent lineage in stramenopiles, were inferred based on RNA-seq data. We found transcripts for proteins known to function in one form of MROs, the hydrogenosome, such as pyruvate:ferredoxin oxidoreductase, iron-hydrogenase, acetate:succinate CoA-transferase, and succinyl-CoA synthase, along with transcripts for acetyl-CoA synthetase (ADP-forming). These proteins possess putative mitochondrial targeting signals at their N-termini, suggesting dual ATP generation systems through anaerobic pyruvate metabolism in Cantina MROs. In addition, MROs in Cantina were also shown to share several features with canonical mitochondria, including amino acid metabolism and an "incomplete" tricarboxylic acid cycle. Transcripts for all four subunits of complex II (CII) of the electron transport chain were detected, while there was no evidence for the presence of complexes I, III, IV, or F1Fo ATPase. Cantina MRO biochemistry challenges the categories of mitochondrial organelles recently proposed.},
}

Mitochondria/*metabolism
Phylogeny
Sequence Analysis, RNA
Stramenopiles/genetics/*metabolism

@article {pmid26436958,
year = {2016},
author = {Wang, FY and Wang, TY and Liao, TY and Liu, MY},
title = {The complete mitochondrial genome sequence of Nemateleotris decora (gobiiformes, gobiidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4274-4275},
doi = {10.3109/19401736.2015.1082091},
pmid = {26436958},
issn = {2470-1408},
mesh = {Animals ; Base Composition/genetics ; DNA, Mitochondrial/genetics ; Gene Order/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/*genetics ; Perciformes/*genetics ; Phylogeny ; RNA, Ribosomal/genetics ; RNA, Transfer/genetics ; Sequence Analysis, DNA/methods ; Whole Genome Sequencing/methods ; },
abstract = {We determined the mitochondrial genome (mitogenome) sequence of Nemateleotris decora by using a long polymerase chain reaction (PCR) method and next-generation sequence (NGS) technology. The total length of N. decora mitogenome is 16 502 bp, consisting of 13 protein-coding genes, 22 transfer RNAs, two ribosomal RNAs genes, and a non-coding control region. The overall base composition of N. decora is 25.22% for A, 25.90% for T, 30.69% for G, and 18.19% for C. Our results showed the complete mitogenome is a good marker for the phylogenetic study.},
}

Animals
Base Composition/genetics
DNA, Mitochondrial/genetics
Gene Order/genetics
Genome, Mitochondrial/*genetics
Mitochondria/*genetics
Perciformes/*genetics
Phylogeny
RNA, Ribosomal/genetics
RNA, Transfer/genetics
Sequence Analysis, DNA/methods
Whole Genome Sequencing/methods

@article {pmid26444283,
year = {2015},
author = {Greig, K and Boocock, J and Prost, S and Horsburgh, KA and Jacomb, C and Walter, R and Matisoo-Smith, E},
title = {Complete Mitochondrial Genomes of New Zealand's First Dogs.},
journal = {PloS one},
volume = {10},
number = {10},
pages = {e0138536},
pmid = {26444283},
issn = {1932-6203},
mesh = {Animals ; DNA, Mitochondrial/genetics ; Dogs/*genetics ; Genetics, Population/methods ; Genome, Mitochondrial/*genetics ; Geography/methods ; Haplotypes/genetics ; Indonesia ; Mitochondria/*genetics ; New Zealand ; Pacific Ocean ; Phylogeny ; Sequence Analysis, DNA/methods ; },
abstract = {Dogs accompanied people in their migrations across the Pacific Ocean and ultimately reached New Zealand, which is the southern-most point of their oceanic distribution, around the beginning of the fourteenth century AD. Previous ancient DNA analyses of mitochondrial control region sequences indicated the New Zealand dog population included two lineages. We sequenced complete mitochondrial genomes of fourteen dogs from the colonisation era archaeological site of Wairau Bar and found five closely-related haplotypes. The limited number of mitochondrial lineages present at Wairau Bar suggests that the founding population may have comprised only a few dogs; or that the arriving dogs were closely related. For populations such as that at Wairau Bar, which stemmed from relatively recent migration events, control region sequences have insufficient power to address questions about population structure and founding events. Sequencing mitogenomes provided the opportunity to observe sufficient diversity to discriminate between individuals that would otherwise be assigned the same haplotype and to clarify their relationships with each other. Our results also support the proposition that at least one dispersal of dogs into the Pacific was via a south-western route through Indonesia.},
}

Animals
DNA, Mitochondrial/genetics
Dogs/*genetics
Genetics, Population/methods
Genome, Mitochondrial/*genetics
Geography/methods
Haplotypes/genetics
Indonesia
Mitochondria/*genetics
New Zealand
Pacific Ocean
Phylogeny
Sequence Analysis, DNA/methods

@article {pmid26453092,
year = {2016},
author = {Marangi, M and Hall, MJ and Aitken, A and Ready, PD and Giangaspero, A},
title = {Origins of Wohlfahrtia magnifica in Italy based on the identification of mitochondrial cytochrome b gene haplotypes.},
journal = {Parasitology research},
volume = {115},
number = {2},
pages = {483-487},
pmid = {26453092},
issn = {1432-1955},
mesh = {Animals ; Cytochromes b/*genetics ; Europe ; *Genes, Mitochondrial ; Geography ; Haplotypes ; Italy/epidemiology ; Larva ; Mitochondria ; Myiasis/epidemiology/parasitology/*veterinary ; Phylogeny ; Polymerase Chain Reaction ; Sarcophagidae/*genetics ; Sheep ; Sheep Diseases/epidemiology/*parasitology ; },
abstract = {To identify the geographical origins of larvae of Wohlfahrtia magnifica (Diptera: Sarcophagidae) causing myiasis of sheep in Italy, comparative DNA sequence analysis of the mitochondrial cytochrome b gene was performed, based on gene fragments amplified by PCR from genomic DNA isolated from individual specimens. DNA extractions of 19 larvae from Lazio, Molise, Puglia, and Sicilia generated 17 readable sequences homologous to 2 haplotypes, either CB_magn01 or CB_magn02; DNA extracts from 4 adult flies from Calabria (reared from larvae) produced 4 readable sequences belonging to the haplotype CB_magn01. The two haplotypes found represent both the East and West phylogenetic lineages of W. magnifica, which is consistent with the species' arrival from central/southeast Europe (East lineage) and/or from southwest Europe/northwest Africa (West lineage). This is the first report of the sympatric occurrence of the two lineages, which could have resulted from natural or human-assisted dispersal. Polymorphic nuclear loci will have to be characterized in order to explain the origins and lack of mitochondrial haplotype diversity of this pest in Italy, where it poses increasing veterinary problems.},
}

Animals
Cytochromes b/*genetics
Europe
*Genes, Mitochondrial
Geography
Haplotypes
Italy/epidemiology
Larva
Mitochondria
Myiasis/epidemiology/parasitology/*veterinary
Phylogeny
Polymerase Chain Reaction
Sarcophagidae/*genetics
Sheep
Sheep Diseases/epidemiology/*parasitology

@article {pmid26457491,
year = {2016},
author = {Liu, F and Bao, X and Fan, Y and Li, J and Yao, X},
title = {Sequencing and analysis of the complete mitochondrial genome of Brown Shrike, Lanius cristatus (Passeriformes, Laniidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3544-3546},
doi = {10.3109/19401736.2015.1074210},
pmid = {26457491},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Genes, rRNA ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Passeriformes/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {The complete mitochondrial genome of the Brown Shrike (Lanius cristatus) was 16 821 bp in length. The accession number was KT004451 and the contents of A, T, C, and G were 31.10%(5237 bp), 25.60%(4309 bp), 28.60%(4814 bp), and 14.60%(2461 bp), respectively. Gene organization and length was similar to other species of birds. It comprises of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 1 control region. All protein-coding genes use the typical initiation codon ATG, except for COX1 which was initiated with GTG. All the complete stop codon was coincident with the Black-headed Gull (Chroicocephalus ridibundus) and the Grey-backed Shrike (Lanius tephronotus), except for ND2, which was terminated with TAG. In addition, the phylogenetic relationships of Passeriformes based on complete mitochondrial genomes showed that the genetic distance of Laniidae and Corvidae was closer than others.},
}

Animals
Base Composition
Genes, rRNA
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Passeriformes/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods

@article {pmid26462546,
year = {2016},
author = {Sun, Z and Wang, B and Sun, X and Yan, L and Pan, T and Zhang, B},
title = {Phylogenetic studies of Anas clypeata (Anatidae: Anas) based on complete mitochondrial DNA sequences.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4320-4321},
doi = {10.3109/19401736.2015.1089482},
pmid = {26462546},
issn = {2470-1408},
mesh = {Animals ; Base Composition/genetics ; Base Sequence/genetics ; Conserved Sequence/genetics ; DNA, Mitochondrial/*genetics ; Ducks/*genetics ; Gene Order/genetics ; Genes, Mitochondrial/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/genetics ; Phylogeny ; Sequence Analysis, DNA/methods ; },
abstract = {Northern shoveler (Anas clypeata) is a middle-sized duck living in an extremely geographical range in northern hemisphere. Here, the complete mitochondrial genome of A. clypeata (16 599 bp in length) has been analyzed for building the database. Similar to the typical mtDNA of vertebrates, it contained 37 genes (13 protein-coding genes, 2 rRNA genes and 22 tRNA genes) and a non-coding region (D-loop). Overall base composition of the complete mitochondrial DNA is A (29.4%), G (15.7%), C (32.5%) and T (22.4%), the percentage of A and T (51.8%) is slightly higher than G and C (48.2%). All the genes in A. clypeata were distributed on the H-strand, except for the ND6 subunit gene and 9 tRNA genes which were encoded on the L-strand. The phylogenetic relationships of 12 Anatidae species were reconstructed based on the complete mtDNA sequences using the Bayesian inference method.},
}

Animals
Base Composition/genetics
Base Sequence/genetics
Conserved Sequence/genetics
DNA, Mitochondrial/*genetics
Ducks/*genetics
Gene Order/genetics
Genes, Mitochondrial/genetics
Genome, Mitochondrial/*genetics
Mitochondria/genetics
Phylogeny
Sequence Analysis, DNA/methods

@article {pmid26463086,
year = {2016},
author = {Hao, RC and Wang, GH and Yang, GZ and Zan, LS},
title = {The complete mitochondrial genome sequence of Zebrias crossolepis (pleuronectiformes: soleidae) and Acrossocheilus monticola (cypriniformes: cyprinidae) and phylogenetic studies.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4326-4327},
doi = {10.3109/19401736.2015.1089485},
pmid = {26463086},
issn = {2470-1408},
mesh = {Animals ; Base Composition/genetics ; Base Sequence/genetics ; Conserved Sequence/genetics ; Cyprinidae/genetics ; Cypriniformes/*genetics ; DNA, Mitochondrial/*genetics ; Flatfishes/*genetics ; Gene Order/genetics ; Genes, Mitochondrial/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/genetics ; Phylogeny ; Sequence Analysis, DNA/methods ; Whole Genome Sequencing ; },
abstract = {In this study, two complete mitogenome sequences of Zebrias crossolepis and Acrossocheilus monticola were determined and the phylogenetic relationship were constructed based on concatenated nucleotide sequences of 12 mitochondrial protein-coding genes. The length of the complete mitogenome sequence are 16 775 bp and 16 605 bp in Z. crossolepis and A. monticola, respectively, both containing 13 protein-coding genes, two rRNA genes, 22 tRNA genes, a putative control region (CR), and a light-strand replication origin (OL). The overall base composition is 28.3% A, 26.3% T, 30.0% C, 15.5% G, with a slight AT bias (54.6%) in Z. crossolepis, while 31.4% A, 24.5% T, 28.2% C, 15.9% G, with an slight AT bias (55.9%) in A. monticola. All the protein-coding genes use the initiation codon ATG except COI uses GTG. Most of them have TAA or TAG as the stop codon, while ND4 and Cytb in Z. crossolepis and COII, ND4, and Cytb in A. monticola use an incomplete stop codon T. These results are expected to provide useful molecular data for species identification and further phylogenetic studies.},
}

Animals
Base Composition/genetics
Base Sequence/genetics
Conserved Sequence/genetics
Cyprinidae/genetics
Cypriniformes/*genetics
DNA, Mitochondrial/*genetics
Flatfishes/*genetics
Gene Order/genetics
Genes, Mitochondrial/genetics
Genome, Mitochondrial/*genetics
Mitochondria/genetics
Phylogeny
Sequence Analysis, DNA/methods
Whole Genome Sequencing

@article {pmid26465068,
year = {2016},
author = {Doña, J and Ruiz-Ruano, FJ and Jovani, R},
title = {DNA barcoding of Iberian Peninsula and North Africa Tawny Owls Strix aluco suggests the Strait of Gibraltar as an important barrier for phylogeography.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4475-4478},
doi = {10.3109/19401736.2015.1089573},
pmid = {26465068},
issn = {2470-1408},
mesh = {Africa, Northern ; Animals ; Bayes Theorem ; DNA/chemistry/isolation & purification/metabolism ; *DNA Barcoding, Taxonomic ; Genetic Variation ; Gibraltar ; Mitochondria/genetics ; Phylogeny ; Phylogeography ; Sequence Analysis, DNA ; Strigiformes/classification/*genetics ; },
abstract = {Eight subspecies have been proposed within the Tawny Owl (Strix aluco) species. However, recent molecular data have challenged this view, encouraging further work in this species complex. Here we reevaluated the taxonomic status between the North-Western African Tawny Owl, S. a. mauritanica, and its closest Iberian Tawny Owl population (from the S. a. sylvatica to S. a. aluco clade) separated by the Strait of Gibraltar. The Tawny Owl is a non-migratory and territorial species, and juvenile dispersal is restricted to a few kilometers around the natal site. This limited dispersal and the barrier imposed by the Strait of Gibraltar predicted a strong differentiation between the two populations. We tested this using DNA barcoding, Bayesian phylogenetic and species delimitation analysis. We found that an 81.1% of variation is due to the intergroups variation. In addition, the inter-intraspecific distances distribution revealed a barcoding gap among the two subspecies. Also, posterior probabilities and the PAB value allowed to reject the hypothesis that observed degree of distinctiveness is due to random coalescence processes. These findings clearly support the Strait of Gibraltar as an isolating barrier for this species. The subspecific status is confirmed and species status is even suggested for S. a. mauritanica.},
}

Africa, Northern
Animals
Bayes Theorem
DNA/chemistry/isolation & purification/metabolism
*DNA Barcoding, Taxonomic
Genetic Variation
Gibraltar
Mitochondria/genetics
Phylogeny
Phylogeography
Sequence Analysis, DNA
Strigiformes/classification/*genetics

@article {pmid26486753,
year = {2016},
author = {Chen, D and Zhang, K and Liu, S and Chen, F},
title = {The complete mitochondrial genome of the Dipodomys ordii (Ord's kangaroo rat).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4322-4323},
doi = {10.3109/19401736.2015.1089483},
pmid = {26486753},
issn = {2470-1408},
mesh = {Animals ; Base Composition/genetics ; Base Sequence/genetics ; Conserved Sequence/genetics ; DNA, Mitochondrial/*genetics ; Dipodomys/*genetics ; Gene Order/genetics ; Genes, Mitochondrial/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/genetics ; Phylogeny ; Sequence Analysis, DNA/methods ; },
abstract = {Ord's kangaroo rat is a kangaroo rat native to western North America. In this study, we first reported the complete mitochondrial genome of Dipodomys ordii that the first has the complete mitochondrial genome in the genus of Heteromyidae. The mitogenome is a circular molecule of 16 257 bp in length, containing 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs and a putative displacement loop region. All protein-coding genes started with a traditional ATN codon and terminated with the mitochondria stop codon (TAA/TAG/AGA) or a single T base. The gene order and composition of mitogenome was similar to that of most other Sciurognathi species and its GC content was 36.73%. Thirteen protein-coding genes of D. ordii together with eight other closely species were used to construct the species phylogenetic tree for verification of the accuracy of new determined mitogenome sequences.},
}

Animals
Base Composition/genetics
Base Sequence/genetics
Conserved Sequence/genetics
DNA, Mitochondrial/*genetics
Dipodomys/*genetics
Gene Order/genetics
Genes, Mitochondrial/genetics
Genome, Mitochondrial/*genetics
Mitochondria/genetics
Phylogeny
Sequence Analysis, DNA/methods

@article {pmid26486988,
year = {2016},
author = {Yang, H and Bao, X and Wang, B and Liu, W},
title = {The complete mitochondrial genome of Chirolophis japonicus (Perciformes: Stichaeidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4419-4420},
doi = {10.3109/19401736.2015.1089552},
pmid = {26486988},
issn = {2470-1408},
mesh = {Amino Acid Sequence/genetics ; Animals ; Base Composition/genetics ; DNA, Mitochondrial/genetics ; Genes, Mitochondrial/genetics ; Genes, rRNA/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/genetics ; Perciformes/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/methods ; },
abstract = {The complete mitochondrial genome of Chirolophis japonicus was sequenced for the first time in this study. It is a closed-circular molecule of 16 521 bp in length and contains 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes, an origin of light strand replication (OL), and a control region (CR). The overall base composition of the heavy-strand is 25.5% A, 28.6% T, 18.3% G, and 27.6% C, and the lengths of 2 rRNA genes are 946 and 1692 bp, respectively. Maximum likelihood tree based on all the amino acid sequences of 13 mitochondrial PCGs was constructed, in which C. japonicus is close to three species of infraorder Zoarcales. These results are expected to provide useful molecular data for species identification and further phylogenetic studies of genus Chirolophis.},
}

Amino Acid Sequence/genetics
Animals
Base Composition/genetics
DNA, Mitochondrial/genetics
Genes, Mitochondrial/genetics
Genes, rRNA/genetics
Genome, Mitochondrial/*genetics
Mitochondria/genetics
Perciformes/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/methods

@article {pmid26487090,
year = {2016},
author = {Li, Z and Chen, Z and Gao, J and Wang, L and Chen, X and Zhao, Y},
title = {The complete mitochondrial genome of the Symphysodon aequifasciatus (Pellegrin, 1904).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4425-4426},
doi = {10.3109/19401736.2015.1089555},
pmid = {26487090},
issn = {2470-1408},
mesh = {Animals ; Base Composition/genetics ; Cichlids/*genetics ; DNA, Mitochondrial/*genetics ; Gene Order/genetics ; Genes, rRNA/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/methods ; },
abstract = {In this study, the complete mitogenome sequence of the Symphysodon aequifasciatus has been sequenced by next-generation sequencing method. The mitogenome consists of 16 545 bp, including 13 protein-coding genes, 22 transfer RNAs and 2 ribosomal RNAs genes. The overall base composition of the fish is 28.8% for A, 30.1% for C, 15.0% for G, and 26.1% for T, suggesting a 99% identity to S. discus Heckel and a 98% identity to S. haraldi. It provides essential and important DNA molecular data for further phylogeography and evolutionary analysis for Symphysodon phylogeny.},
}

Animals
Base Composition/genetics
Cichlids/*genetics
DNA, Mitochondrial/*genetics
Gene Order/genetics
Genes, rRNA/genetics
Genome, Mitochondrial/*genetics
Mitochondria/genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/methods

@article {pmid26487483,
year = {2016},
author = {Liu, J and Jin, W and Wu, C},
title = {The first complete mitochondrial genome of Serranidae sp. (Percoidea, Serranidae) and phylogenetic analysis based on Bayesian.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4436-4438},
doi = {10.3109/19401736.2015.1089560},
pmid = {26487483},
issn = {2470-1408},
mesh = {Animals ; Base Composition/genetics ; Bayes Theorem ; Conserved Sequence/genetics ; Gene Order/genetics ; Genes, Mitochondrial/genetics ; Genes, rRNA/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/*genetics ; Perciformes/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/methods ; Whole Genome Sequencing/methods ; },
abstract = {In the present study, the complete mitochondrial genome of Serranidae sp. was determined first. The entire mitochondrial genome of Serranidae sp. is 16 512 bp in length, containing 13 protein-coding genes and 2 ribosomal RNA genes (rRNA), 22 transfer RNA genes (tRNA) and 2 main non-coding regions (the control region and the origin of the light-strand replication). The gene arrangement, base composition and tRNA structures of Serranidae sp. are similar to most of the bony fishes. The central conserved sequence blocks (CSB-1, CSB-2, and CSB-3) and the core sequence (ACATATATGT) of terminal-associated sequences were recognized in the control region. Meanwhile, the conserved motif 5'-GCCGG-3' was identified in the origin of light-strand replication of Serranidae sp. Phylogenetic tree, which is constructed based on the complete mitochondrial genome sequences of Serranidae sp., shows that Serranidae sp. is clustered with the fishes of the family Pentacerotidae. We expect that the mitochondrial genome of Serranidae sp. would play a key role in phylogenetic analysis of Serranidae.},
}

Animals
Base Composition/genetics
Bayes Theorem
Conserved Sequence/genetics
Gene Order/genetics
Genes, Mitochondrial/genetics
Genes, rRNA/genetics
Genome, Mitochondrial/*genetics
Mitochondria/*genetics
Perciformes/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/methods
Whole Genome Sequencing/methods

@article {pmid26488305,
year = {2016},
author = {Liu, JB and Zeng, YF and Yuan, C and Yue, YJ and Ding, XZ and Guo, TT and Han, JL and Feng, RL and Sun, XP and Niu, CE and Yang, BH and Guo, J},
title = {The complete mitochondrial genome sequence of the dwarf blue sheep, Pseudois schaeferi haltenorth in China.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4411-4413},
doi = {10.3109/19401736.2015.1089548},
pmid = {26488305},
issn = {2470-1408},
mesh = {Animals ; China ; DNA, Mitochondrial/genetics ; Genes, Mitochondrial/genetics ; Genes, rRNA/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/methods ; Sheep/*genetics ; Whole Genome Sequencing/methods ; },
abstract = {The dwarf blue sheep (Pseudois schaeferi haltenorth) belongs the subfamily Caprinae, which is distributed in Sichuan, Tibet, Yunnan, and Qinghai in China. In this study, the complete mitochondrial genome of Pseudois schaeferi haltenorth was sequenced. The mitogenome was 16 741 bp in length, consisting of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and a non-coding control region (D-loop region). As in other mammals, most mitochondrial genes are encoded on the heavy strand, except for ND6 and eight tRNA genes which are encoded on the light strand. The overall base composition of the Pseudois schaeferi haltenorth is 33.54% A, 26.37% T, 26.91% C, and 13.18% G, A + T (59.91%) was higher than G + C (40.09%). The phylogenetic relationships was analyzed using the complete mitogenome sequence, results show that P. schaeferi haltenorth should be a different species differ from the Genus pseudois hodgson. These information provide useful data for further study on the protection of genetic resources and the taxonomy of Caprinae.},
}

Animals
China
DNA, Mitochondrial/genetics
Genes, Mitochondrial/genetics
Genes, rRNA/genetics
Genome, Mitochondrial/*genetics
Mitochondria/genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/methods
Sheep/*genetics
Whole Genome Sequencing/methods

@article {pmid26503662,
year = {2016},
author = {Nuralitha, S and Siregar, JE and Syafruddin, D and Roelands, J and Verhoef, J and Hoepelman, AI and Marzuki, S},
title = {Within-Host Selection of Drug Resistance in a Mouse Model of Repeated Incomplete Malaria Treatment: Comparison between Atovaquone and Pyrimethamine.},
journal = {Antimicrobial agents and chemotherapy},
volume = {60},
number = {1},
pages = {258-263},
pmid = {26503662},
issn = {1098-6596},
mesh = {Amino Acid Substitution ; Animals ; Antimalarials/*pharmacology ; Atovaquone/*pharmacology ; Cell Nucleus/drug effects/enzymology/genetics ; Cytochromes b/*genetics/metabolism ; Drug Resistance/drug effects/*genetics ; Gene Expression ; Host-Parasite Interactions ; Malaria/drug therapy/parasitology ; Mice ; Mice, Inbred BALB C ; Mitochondria/drug effects/enzymology/genetics ; Mutation Rate ; Parasitic Sensitivity Tests ; Plasmodium berghei/*drug effects/enzymology/genetics ; Protozoan Proteins/genetics/metabolism ; Pyrimethamine/*pharmacology ; Selection, Genetic ; Tetrahydrofolate Dehydrogenase/*genetics/metabolism ; Treatment Failure ; },
abstract = {The evolutionary selection of malaria parasites within individual hosts is an important factor in the emergence of drug resistance but is still not well understood. We have examined the selection process for drug resistance in the mouse malaria agent Plasmodium berghei and compared the dynamics of the selection for atovaquone and pyrimethamine. Resistance to these drugs has been shown to be associated with genetic lesions in the dihydrofolate reductase gene in the case of pyrimethamine and in the mitochondrial cytochrome b gene for atovaquone. A mouse malaria model for the selection of drug resistance, based on repeated incomplete treatment (RICT) with a therapeutic dose of antimalarial drugs, was established. The number of treatment cycles for the development of stable resistance to atovaquone (2.47 ± 0.70; n = 19) was found to be significantly lower than for pyrimethamine (5.44 ± 1.46; n = 16; P < 0.0001), even when the parental P. berghei Leiden strain was cloned prior to the resistance selection. Similar results were obtained with P. berghei Edinburgh. Mutational changes underlying the resistance were identified to be S110N in dihydrofolate reductase for pyrimethamine and Y268N, Y268C, Y268S, L271V-K272R, and G280D in cytochrome b for atovaquone. These results are consistent with the rate of mitochondrial DNA mutation being higher than that in the nucleus and suggest that mutation leading to pyrimethamine resistance is not a rare event.},
}

Amino Acid Substitution
Animals
Antimalarials/*pharmacology
Atovaquone/*pharmacology
Cell Nucleus/drug effects/enzymology/genetics
Cytochromes b/*genetics/metabolism
Drug Resistance/drug effects/*genetics
Gene Expression
Host-Parasite Interactions
Malaria/drug therapy/parasitology
Mice
Mice, Inbred BALB C
Mitochondria/drug effects/enzymology/genetics
Mutation Rate
Parasitic Sensitivity Tests
Plasmodium berghei/*drug effects/enzymology/genetics
Protozoan Proteins/genetics/metabolism
Pyrimethamine/*pharmacology
Selection, Genetic
Tetrahydrofolate Dehydrogenase/*genetics/metabolism
Treatment Failure

@article {pmid26507459,
year = {2016},
author = {Ogata, T and Senoo, T and Kawano, S and Ikeda, S},
title = {Mitochondrial superoxide dismutase deficiency accelerates chronological aging in the fission yeast Schizosaccharomyces pombe.},
journal = {Cell biology international},
volume = {40},
number = {1},
pages = {100-106},
doi = {10.1002/cbin.10556},
pmid = {26507459},
issn = {1095-8355},
mesh = {Aging/*metabolism ; Antioxidants/metabolism ; DNA, Fungal/genetics ; Mitochondria/metabolism ; Mutation ; Mutation Rate ; Oxidative Stress/physiology ; Reactive Oxygen Species/metabolism ; Schizosaccharomyces/cytology/*enzymology/genetics ; Schizosaccharomyces pombe Proteins/genetics/*metabolism ; Superoxide Dismutase/*deficiency/genetics/metabolism ; Superoxides/metabolism ; Superoxide Dismutase 2 ; },
abstract = {A mitochondrial superoxide dismutase (SOD2) is the first line of antioxidant defense against mitochondrial superoxide. Even though the involvement of SOD2 in lifespan has been studied extensively in several organisms, characterization of the aging process has not been performed for the sod2 mutant (sod2Δ) of a prominent model Schizosaccharomyces pombe. In this study, we measured the chronological lifespan of sod2Δ cells by their ability to survive in long-term culture. SOD2 deficiency drastically decreased cell viability in the stationary phase. The mutation frequency of nuclear DNA in sod2Δ was elevated in the stationary phase, and cellular proteins and nuclear DNA were extensively degraded, concurrent with cell death. The sod2 gene in wild-type cells could be induced by an increase in endogenous oxidative stresses, after which, SOD2 activity was substantially elevated during the stationary phase. Culture in a lower glucose concentration (calorie restriction) prominently extended the sod2Δ lifespan. Therefore, S. pombe SOD2 plays a critical role in longevity through its upregulation in the non-dividing phase.},
}

Aging/*metabolism
Antioxidants/metabolism
DNA, Fungal/genetics
Mitochondria/metabolism
Mutation
Mutation Rate
Oxidative Stress/physiology
Reactive Oxygen Species/metabolism
Schizosaccharomyces/cytology/*enzymology/genetics
Schizosaccharomyces pombe Proteins/genetics/*metabolism
Superoxide Dismutase/*deficiency/genetics/metabolism
Superoxides/metabolism
Superoxide Dismutase 2

@article {pmid26510618,
year = {2016},
author = {Yu, P and Yang, QC and Ding, SQ and Zhang, J and Li, XL and Bi, ZH and Wan, Q},
title = {The complete sequence of mitochondrial genome of Sinibotia pulchra (Cypriniformes: Cobitidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4318-4319},
doi = {10.3109/19401736.2015.1089481},
pmid = {26510618},
issn = {2470-1408},
mesh = {Animals ; Base Composition/genetics ; Base Sequence/genetics ; Conserved Sequence/genetics ; Cyprinidae/genetics ; Cypriniformes/*genetics ; DNA, Mitochondrial/*genetics ; Gene Order/genetics ; Genes, Mitochondrial/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/genetics ; Phylogeny ; Sequence Analysis, DNA/methods ; },
abstract = {Sinibotia pulchra (Cypriniformes: Cobitidae) is a small cyprinid fish. In this study, the complete mitochondrial genome sequence of S. pulchra is sequenced. The S. pulchra complete mitochondrial genome (GenBank accession no. KT362179) was a circular molecule of 16 568 bp in length, with 13 protein-coding genes (PCGs), 2 ribosome RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, an L-strand replication origin (OL) and a control region (D-loop). The nucleotide acid composition of the entire mitogenome was 31.69% for A, 25.63% for T, 26.94% for C and 15.74% for G, with an AT content of 57.32%. The AT content of 12S rRNA, 16S rRNA and D-loop was 50.21%, 56.86% and 66.74%, respectively.},
}

Animals
Base Composition/genetics
Base Sequence/genetics
Conserved Sequence/genetics
Cyprinidae/genetics
Cypriniformes/*genetics
DNA, Mitochondrial/*genetics
Gene Order/genetics
Genes, Mitochondrial/genetics
Genome, Mitochondrial/*genetics
Mitochondria/genetics
Phylogeny
Sequence Analysis, DNA/methods

@article {pmid26517908,
year = {2015},
author = {Schaedler, TA and Faust, B and Shintre, CA and Carpenter, EP and Srinivasan, V and van Veen, HW and Balk, J},
title = {Structures and functions of mitochondrial ABC transporters.},
journal = {Biochemical Society transactions},
volume = {43},
number = {5},
pages = {943-951},
doi = {10.1042/BST20150118},
pmid = {26517908},
issn = {1470-8752},
support = {106169/WT_/Wellcome Trust/United Kingdom ; BB/H00288X/1/BB_/Biotechnology and Biological Sciences Research Council/United Kingdom ; },
mesh = {ATP-Binding Cassette Transporters/classification/genetics/*metabolism ; Animals ; Crystallography, X-Ray ; Humans ; Mitochondria/*metabolism ; Mitochondrial Proteins/chemistry/genetics/*metabolism ; Mutation ; Phylogeny ; Plant Proteins/chemistry/genetics/metabolism ; Saccharomyces cerevisiae/chemistry/genetics/metabolism ; },
abstract = {A small number of physiologically important ATP-binding cassette (ABC) transporters are found in mitochondria. Most are half transporters of the B group forming homodimers and their topology suggests they function as exporters. The results of mutant studies point towards involvement in iron cofactor biosynthesis. In particular, ABC subfamily B member 7 (ABCB7) and its homologues in yeast and plants are required for iron-sulfur (Fe-S) cluster biosynthesis outside of the mitochondria, whereas ABCB10 is involved in haem biosynthesis. They also play a role in preventing oxidative stress. Mutations in ABCB6 and ABCB7 have been linked to human disease. Recent crystal structures of yeast Atm1 and human ABCB10 have been key to identifying substrate-binding sites and transport mechanisms. Combined with in vitro and in vivo studies, progress is being made to find the physiological substrates of the different mitochondrial ABC transporters.},
}

ATP-Binding Cassette Transporters/classification/genetics/*metabolism
Animals
Crystallography, X-Ray
Humans
Mitochondria/*metabolism
Mitochondrial Proteins/chemistry/genetics/*metabolism
Mutation
Phylogeny
Plant Proteins/chemistry/genetics/metabolism
Saccharomyces cerevisiae/chemistry/genetics/metabolism

@article {pmid26530087,
year = {2015},
author = {Wagner, S and Behera, S and De Bortoli, S and Logan, DC and Fuchs, P and Carraretto, L and Teardo, E and Cendron, L and Nietzel, T and Füßl, M and Doccula, FG and Navazio, L and Fricker, MD and Van Aken, O and Finkemeier, I and Meyer, AJ and Szabò, I and Costa, A and Schwarzländer, M},
title = {The EF-Hand Ca2+ Binding Protein MICU Choreographs Mitochondrial Ca2+ Dynamics in Arabidopsis.},
journal = {The Plant cell},
volume = {27},
number = {11},
pages = {3190-3212},
pmid = {26530087},
issn = {1532-298X},
mesh = {Arabidopsis/genetics/*metabolism ; Arabidopsis Proteins/*metabolism ; Calcium ; Calcium Signaling ; Calcium-Binding Proteins/*metabolism ; Cell Respiration ; Cytosol/metabolism ; DNA, Bacterial/genetics ; *EF Hand Motifs ; Mitochondria/*metabolism/ultrastructure ; Mutagenesis, Insertional/genetics ; Phylogeny ; Plant Roots/metabolism/ultrastructure ; Protein Binding ; Protein Transport ; Seedlings/metabolism ; Sequence Homology, Amino Acid ; Subcellular Fractions/metabolism ; },
abstract = {Plant organelle function must constantly adjust to environmental conditions, which requires dynamic coordination. Ca(2+) signaling may play a central role in this process. Free Ca(2+) dynamics are tightly regulated and differ markedly between the cytosol, plastid stroma, and mitochondrial matrix. The mechanistic basis of compartment-specific Ca(2+) dynamics is poorly understood. Here, we studied the function of At-MICU, an EF-hand protein of Arabidopsis thaliana with homology to constituents of the mitochondrial Ca(2+) uniporter machinery in mammals. MICU binds Ca(2+) and localizes to the mitochondria in Arabidopsis. In vivo imaging of roots expressing a genetically encoded Ca(2+) sensor in the mitochondrial matrix revealed that lack of MICU increased resting concentrations of free Ca(2+) in the matrix. Furthermore, Ca(2+) elevations triggered by auxin and extracellular ATP occurred more rapidly and reached higher maximal concentrations in the mitochondria of micu mutants, whereas cytosolic Ca(2+) signatures remained unchanged. These findings support the idea that a conserved uniporter system, with composition and regulation distinct from the mammalian machinery, mediates mitochondrial Ca(2+) uptake in plants under in vivo conditions. They further suggest that MICU acts as a throttle that controls Ca(2+) uptake by moderating influx, thereby shaping Ca(2+) signatures in the matrix and preserving mitochondrial homeostasis. Our results open the door to genetic dissection of mitochondrial Ca(2+) signaling in plants.},
}

Arabidopsis/genetics/*metabolism
Arabidopsis Proteins/*metabolism
Calcium
Calcium Signaling
Calcium-Binding Proteins/*metabolism
Cell Respiration
Cytosol/metabolism
DNA, Bacterial/genetics
*EF Hand Motifs
Mitochondria/*metabolism/ultrastructure
Mutagenesis, Insertional/genetics
Phylogeny
Plant Roots/metabolism/ultrastructure
Protein Binding
Protein Transport
Seedlings/metabolism
Sequence Homology, Amino Acid
Subcellular Fractions/metabolism

@article {pmid26535725,
year = {2015},
author = {Andrade, BS and Góes-Neto, A},
title = {Phylogenetic analysis of DNA and RNA polymerases from a Moniliophthora perniciosa mitochondrial plasmid reveals probable lateral gene transfer.},
journal = {Genetics and molecular research : GMR},
volume = {14},
number = {4},
pages = {14105-14114},
doi = {10.4238/2015.October.29.30},
pmid = {26535725},
issn = {1676-5680},
mesh = {Agaricales/*enzymology/*genetics ; Cacao/microbiology ; DNA-Directed DNA Polymerase/*genetics ; DNA-Directed RNA Polymerases/*genetics ; *Gene Transfer, Horizontal ; Genome, Mitochondrial ; Mitochondria/genetics ; Phylogeny ; Plant Diseases/microbiology ; Plasmids/genetics ; Sequence Analysis, DNA ; Sequence Analysis, Protein ; },
abstract = {The filamentous fungus Moniliophthora perniciosa is a hemibiotrophic basidiomycete that causes witches' broom disease of cacao (Theobroma cacao L.). Many fungal mitochondrial plasmids are DNA and RNA polymerase-encoding invertrons with terminal inverted repeats and 5'-linked proteins. The aim of this study was to carry out comparative and phylogenetic analyses of DNA and RNA polymerases for all known linear mitochondrial plasmids in fungi. We performed these analyses at both gene and protein levels and assessed differences between fungal and viral polymerases in order to test the lateral gene transfer (LGT) hypothesis. We analyzed all mitochondrial plasmids of the invertron type within the fungal clade, including five from Ascomycota, seven from Basidiomycota, and one from Chytridiomycota. All phylogenetic analyses generated similar tree topologies regardless of the methods and datasets used. It is likely that DNA and RNA polymerase genes were inserted into the mitochondrial genomes of the 13 fungal species examined in our study as a result of different LGT events. These findings are important for a better understanding of the evolutionary relationships between fungal mitochondrial plasmids.},
}

Agaricales/*enzymology/*genetics
Cacao/microbiology
DNA-Directed DNA Polymerase/*genetics
DNA-Directed RNA Polymerases/*genetics
*Gene Transfer, Horizontal
Genome, Mitochondrial
Mitochondria/genetics
Phylogeny
Plant Diseases/microbiology
Plasmids/genetics
Sequence Analysis, DNA
Sequence Analysis, Protein

@article {pmid26544023,
year = {2016},
author = {Shi, X and Zhu, Q and Wu, N and Tu, J and Yang, D and Xu, H and Yao, Y and Yang, M and Li, D},
title = {The complete nucleotide sequence of the mitochondrial genome of Drosophila formosana (Diptera: Drosophilidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4316-4317},
doi = {10.3109/19401736.2015.1089480},
pmid = {26544023},
issn = {2470-1408},
mesh = {Animals ; Base Composition/genetics ; Base Sequence/genetics ; Conserved Sequence/genetics ; DNA, Mitochondrial/*genetics ; Drosophila/*genetics ; Gene Order/genetics ; Genes, Mitochondrial/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/genetics ; Nucleotides ; Phylogeny ; Sequence Analysis, DNA/methods ; },
abstract = {Drosophila formosana (Diptera: Drosophilidae) belongs to the Drosophilidae group of Drosophila. The mitochondrial genome sequence of Drosophila formosana is determined in this study. Mitochondrion of D. formosana is a circular DNA molecule of the 16 100 nucleotide pairs (bp) that contains one encoding region including 37 genes and 1 non-coding A + T-rich region. The similarity and typicality have been showed by the structure and organization analysis. All genes are arranged in the circular DNA molecule. In addition to DN5 that use GTG start codon, all other protein-coding genes (PCGs) start with an ATN start codon. Ten protein-coding genes stop with the termination codon TAN, while other protein-coding genes (PCGs) used incomplete termination codon TA- (cox2, nad5, nad1). The A + T-rich region with a length of 1088 bp is located between rrnS and trnI. The mitochondrial genome of D. formosana has been completely sequenced for the first time in this study.},
}

Animals
Base Composition/genetics
Base Sequence/genetics
Conserved Sequence/genetics
DNA, Mitochondrial/*genetics
Drosophila/*genetics
Gene Order/genetics
Genes, Mitochondrial/genetics
Genome, Mitochondrial/*genetics
Mitochondria/genetics
Nucleotides
Phylogeny
Sequence Analysis, DNA/methods

@article {pmid26596041,
year = {2015},
author = {Titov, VN},
title = {[THE BIOLOGICAL FUNCTION OF NUTRITION, BIOLOGICAL REACTION OF EXOTROPHY, DEPOSITING AND ENDOTROPHY. THE VISCERAL FATTY CELLS AND ADIPOCYTES - PHYLOGENETICALLY, FUNCTIONALLY AND REGULATORY DIFFERENT POOLS OF FATTY TISSUE].},
journal = {Klinicheskaia laboratornaia diagnostika},
volume = {60},
number = {8},
pages = {14-23},
pmid = {26596041},
issn = {0869-2084},
mesh = {Adipocytes/classification/*metabolism/pathology ; Adiponectin/genetics/metabolism ; Adipose Tissue, Brown/*metabolism/pathology ; Autocrine Communication ; Fatty Acids/metabolism ; Gene Expression Regulation ; Humans ; Intra-Abdominal Fat/*metabolism/pathology ; Leptin/genetics/metabolism ; Lipid Metabolism ; Metabolic Syndrome/genetics/*metabolism/pathology ; Mitochondria/metabolism ; Paracrine Communication ; Phylogeny ; Signal Transduction ; },
abstract = {For billions years, two phylogenetically, functionally and regulatory different pools of fatty cells - visceral fatty acids and adipocytes coexist in vivo. Their becoming occurred at different degrees of phylogenesis. The phylogenetically earlier pool of visceral fatty acids is meant to supply with fatty acids-substrates for gaining energy by those cells which implement biological function of nutrition (trophology), homeostasis, endoecology biological function of adaptation and continuation of species. They have no receptors to phylogenetically later insulin. The adipocytes, later in phylogenesis, implement one biological function - the function of locomotion and they are as insulin-dependent as skeletal myocytes, cardiomyocytes, adipocytes and periportal hepatocytes. The difference in regulation is traced on all levels of "biological perfection " - autocrine (cellular) level, in humoral regulated paracrin cenosises of cells and on the level of organism. In biological function of trophology, paracrin cenosises of visceral fatty acids and adipocytes implement subsequently three biological reactions: exotrophy, deposit of fatty acids and endotrophy. In conditions of humoral regulation of three functionally different biological reactions in paracrin cenosises synthesis of so many humoral mediators is required. The humoral mediators of mechanism of feedback at autocrine level, in paracrin cenosises and at the level of organism are leptin of visceral fatty acids and adiponectin of adipocytes. At the level of organism, phylogenetically earlier paracrin cenosises of fatty cells are regulated by endocrine system. The phylogenetically later paracrin cenosises are regulated by insulin and nuclei of hypothalamus. The metabolic syndrome is a pathology of phylogenetically earlier insulin-independent visceral fatty acids. The obesity is a pathology of phylogenetically later pool of insulin-dependent adipocytes.},
}

Adipocytes/classification/*metabolism/pathology
Adiponectin/genetics/metabolism
Adipose Tissue, Brown/*metabolism/pathology
Autocrine Communication
Fatty Acids/metabolism
Gene Expression Regulation
Humans
Intra-Abdominal Fat/*metabolism/pathology
Leptin/genetics/metabolism
Lipid Metabolism
Metabolic Syndrome/genetics/*metabolism/pathology
Mitochondria/metabolism
Paracrine Communication
Phylogeny
Signal Transduction

@article {pmid26620805,
year = {2016},
author = {Sherrard-Smith, E and Stanton, DW and Cable, J and Orozco-terWengel, P and Simpson, VR and Elmeros, M and van Dijk, J and Simonnet, F and Roos, A and Lemarchand, C and Poledník, L and Heneberg, P and Chadwick, EA},
title = {Distribution and molecular phylogeny of biliary trematodes (Opisthorchiidae) infecting native Lutra lutra and alien Neovison vison across Europe.},
journal = {Parasitology international},
volume = {65},
number = {2},
pages = {163-170},
doi = {10.1016/j.parint.2015.11.007},
pmid = {26620805},
issn = {1873-0329},
mesh = {Animals ; Europe/epidemiology ; France/epidemiology ; Gene Flow ; Germany/epidemiology ; Haplotypes ; Introduced Species ; Mink/*parasitology ; Mitochondria/genetics ; Otters/*parasitology ; Phylogeny ; Poland/epidemiology ; Trematoda/classification/*genetics/*isolation & purification ; Trematode Infections/epidemiology/parasitology/*veterinary ; United Kingdom ; },
abstract = {The recent identification of Pseudamphistomum truncatum, (Rudolphi, 1819) (Trematoda: Opisthorchiidae) and Metorchis bilis (Braun, 1790) Odening, 1962 (synonymous with Metorchis albidus (Braun, 1893) Loos, 1899 and Metorchis crassiusculus (Rudolphi, 1809) Looss, 1899 (Trematoda: Opisthorchiidae)) in otters from Britain caused concern because of associated biliary damage, coupled with speculation over their alien status. Here, we investigate the presence, intensity and phylogeny of these trematodes in mustelids (principally otters) across Europe (Czech Republic, Denmark, France, Germany, Norway, Poland and Sweden and Britain). The trematodes were identified to species using the internal transcribed spacer II (ITS2) locus. Both parasites were found across Europe but at unequal frequency. In the German state of Saxony, eight out of eleven (73%) otters examined were infected with P. truncatum whilst this parasite was not found in either mink from Scotland (n=40) or otters from Norway (n=21). Differences in the phylogenies between the two species suggest divergent demographic histories possibly reflecting contrasting host diet or competitive exclusion, with M. bilis exhibiting greater mitochondrial diversity than P. truncatum. Shared haplotypes within the ranges of both parasite species probably reflect relatively unrestricted movements (both natural and anthropogenic) of intermediate and definitive hosts across Europe.},
}

Animals
Europe/epidemiology
France/epidemiology
Gene Flow
Germany/epidemiology
Haplotypes
Introduced Species
Mink/*parasitology
Mitochondria/genetics
Otters/*parasitology
Phylogeny
Poland/epidemiology
Trematoda/classification/*genetics/*isolation & purification
Trematode Infections/epidemiology/parasitology/*veterinary
United Kingdom

@article {pmid26627655,
year = {2015},
author = {Janardan, N and Harijan, RK and Kiema, TR and Wierenga, RK and Murthy, MR},
title = {Structural characterization of a mitochondrial 3-ketoacyl-CoA (T1)-like thiolase from Mycobacterium smegmatis.},
journal = {Acta crystallographica. Section D, Biological crystallography},
volume = {71},
number = {Pt 12},
pages = {2479-2493},
doi = {10.1107/S1399004715019331},
pmid = {26627655},
issn = {1399-0047},
mesh = {Acetyl-CoA C-Acyltransferase/*chemistry/genetics/metabolism ; Amino Acid Sequence ; Bacterial Proteins/*chemistry/genetics/metabolism ; Catalytic Domain ; Crystallography, X-Ray ; Escherichia coli/genetics/metabolism ; Gene Expression ; Kinetics ; Mitochondria/*chemistry/enzymology ; Mitochondrial Proteins/*chemistry/genetics/metabolism ; Models, Molecular ; Molecular Sequence Data ; Mycobacterium smegmatis/*chemistry/classification/enzymology ; Phylogeny ; Protein Binding ; Protein Multimerization ; Protein Structure, Secondary ; Protein Subunits/*chemistry/genetics/metabolism ; Recombinant Proteins/chemistry/genetics/metabolism ; Sequence Alignment ; Substrate Specificity ; },
abstract = {Thiolases catalyze the degradation and synthesis of 3-ketoacyl-CoA molecules. Here, the crystal structures of a T1-like thiolase (MSM-13 thiolase) from Mycobacterium smegmatis in apo and liganded forms are described. Systematic comparisons of six crystallographically independent unliganded MSM-13 thiolase tetramers (dimers of tight dimers) from three different crystal forms revealed that the two tight dimers are connected to a rigid tetramerization domain via flexible hinge regions, generating an asymmetric tetramer. In the liganded structure, CoA is bound to those subunits that are rotated towards the tip of the tetramerization loop of the opposing dimer, suggesting that this loop is important for substrate binding. The hinge regions responsible for this rotation occur near Val123 and Arg149. The Lα1-covering loop-Lα2 region, together with the Nβ2-Nα2 loop of the adjacent subunit, defines a specificity pocket that is larger and more polar than those of other tetrameric thiolases, suggesting that MSM-13 thiolase has a distinct substrate specificity. Consistent with this finding, only residual activity was detected with acetoacetyl-CoA as the substrate in the degradative direction. No activity was observed with acetyl-CoA in the synthetic direction. Structural comparisons with other well characterized thiolases suggest that MSM-13 thiolase is probably a degradative thiolase that is specific for 3-ketoacyl-CoA molecules with polar, bulky acyl chains.},
}

Acetyl-CoA C-Acyltransferase/*chemistry/genetics/metabolism
Amino Acid Sequence
Bacterial Proteins/*chemistry/genetics/metabolism
Catalytic Domain
Crystallography, X-Ray
Escherichia coli/genetics/metabolism
Gene Expression
Kinetics
Mitochondria/*chemistry/enzymology
Mitochondrial Proteins/*chemistry/genetics/metabolism
Models, Molecular
Molecular Sequence Data
Mycobacterium smegmatis/*chemistry/classification/enzymology
Phylogeny
Protein Binding
Protein Multimerization
Protein Structure, Secondary
Protein Subunits/*chemistry/genetics/metabolism
Recombinant Proteins/chemistry/genetics/metabolism
Sequence Alignment
Substrate Specificity

@article {pmid26634536,
year = {2015},
author = {Xu, X and Tan, YP and Cheng, G and Liu, XQ and Xia, CJ and Luo, FY and Wang, CT},
title = {Genomic survey and gene expression analysis of the VDAC gene family in rice.},
journal = {Genetics and molecular research : GMR},
volume = {14},
number = {4},
pages = {15683-15696},
doi = {10.4238/2015.December.1.20},
pmid = {26634536},
issn = {1676-5680},
mesh = {Chromosome Mapping ; Cluster Analysis ; Computational Biology/methods ; Gene Duplication ; Gene Expression Profiling ; *Gene Expression Regulation, Plant ; Gene Order ; Gene Regulatory Networks ; Genetic Loci ; Genome, Plant ; *Genomics ; *Multigene Family ; Oryza/classification/*genetics/metabolism ; Phylogeny ; Voltage-Dependent Anion Channels/*genetics/metabolism ; },
abstract = {The voltage-dependent anion channel (VDAC), also known as a mitochondrial porin, plays an important role in the regulation of metabolic and energetic functions of mitochondria, as well as in mitochondria-mediated apoptosis. Cytoplasmic male sterility (CMS) is of major economic importance for commercial hybrid production and a research model for the interaction be-tween nuclear and cytoplasmic genomes. Recent research has revealed that CMS is associated with programmed cell death. Here, we used the Honglian (HL)-CMS line of rice (Oryza sativa) as material to investigate the association of O. sativa VDAC (OsVDAC) expression to CMS. Eight VDACs were extracted from rice in this study. Bioinformatic analysis of the rice VDACs was conducted at the DNA, cDNA, and protein level. Expression patterns of OsVDACs were analyzed in different organs and during different stages of pollen development using sterile line YuetaiA (YTA), and its maintainer line YuetaiB (YTB). Differential expression of OsVDACs between YTA and YTB was observed, suggesting that VDACs may be involved in the formation of HL-CMS.},
}

Chromosome Mapping
Cluster Analysis
Computational Biology/methods
Gene Duplication
Gene Expression Profiling
*Gene Expression Regulation, Plant
Gene Order
Gene Regulatory Networks
Genetic Loci
Genome, Plant
*Genomics
*Multigene Family
Oryza/classification/*genetics/metabolism
Phylogeny
Voltage-Dependent Anion Channels/*genetics/metabolism

@article {pmid26653218,
year = {2015},
author = {Huchon, D and Szitenberg, A and Shefer, S and Ilan, M and Feldstein, T},
title = {Mitochondrial group I and group II introns in the sponge orders Agelasida and Axinellida.},
journal = {BMC evolutionary biology},
volume = {15},
number = {},
pages = {278},
pmid = {26653218},
issn = {1471-2148},
mesh = {Animals ; Base Sequence ; Electron Transport Complex IV/genetics ; Gene Transfer, Horizontal ; Genome, Mitochondrial ; *Introns ; Molecular Sequence Data ; Phylogeny ; Porifera/*classification/*genetics ; RNA Splicing ; },
abstract = {BACKGROUND: Self-splicing introns are present in the mitochondria of members of most eukaryotic lineages. They are divided into Group I and Group II introns, according to their secondary structure and splicing mechanism. Being rare in animals, self-splicing introns were only described in a few sponges, cnidarians, placozoans and one annelid species. In sponges, three types of mitochondrial Group I introns were previously described in two demosponge families (Tetillidae, and Aplysinellidae) and in the homoscleromorph family Plakinidae. These three introns differ in their insertion site, secondary structure and in the sequence of the LAGLIDADG gene they encode. Notably, no group II introns have been previously described in sponges.

RESULTS: We report here the presence of mitochondrial introns in the cytochrome oxidase subunit 1 (COI) gene of three additional sponge species from three different families: Agelas oroides (Agelasidae, Agelasida), Cymbaxinella (p) verrucosa (Hymerhabdiidae, Agelasida) and Axinella polypoides (Axinellidae, Axinellida). We show, for the first time, that sponges can also harbour Group II introns in their COI gene, whose presence in animals' mitochondria has so far been described in only two phyla, Placozoa and Annelida. Surprisingly, two different Group II introns were discovered in the COI gene of C. verrucosa. Phylogenetic analysis indicates that the Group II introns present in C. verrucosa are related to red algae (Rhodophyta) introns.

CONCLUSIONS: The differences found among intron secondary structures and the phylogenetic inferences support the hypothesis that the introns originated from independent horizontal gene transfer events. Our results thus suggest that self-splicing introns are more diverse in the mitochondrial genome of sponges than previously anticipated.},
}

Animals
Base Sequence
Electron Transport Complex IV/genetics
Gene Transfer, Horizontal
Genome, Mitochondrial
*Introns
Molecular Sequence Data
Phylogeny
Porifera/*classification/*genetics
RNA Splicing

@article {pmid26678550,
year = {2016},
author = {Huang, R and Zhou, Y and Yao, Y and Zhao, B and Zhang, Y and Xu, HL},
title = {Complete mitochondrial genome and phylogenetic relationship analysis of Garrulax affinis (Passeriformes, Timaliidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {5},
pages = {3502-3503},
doi = {10.3109/19401736.2015.1066368},
pmid = {26678550},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; DNA, Ribosomal/genetics ; Gene Order ; Genome Size ; *Genome, Mitochondrial ; Mitochondria/*genetics ; Passeriformes/*genetics ; Phylogeny ; RNA, Transfer/genetics ; Sequence Analysis, DNA/*methods ; },
abstract = {Garrulax affinis was a medium-sized bird of Timaliidae, and we got its complete mitochondrial genome by the polymerase chain reaction method (PCR). The genome (17 856 in length), it contained 13 protein-coding genes, 2 rRNA (12S and 16S) genes, 2 tRNA genes, 2 control regions (D-loop). All protein-coding, rRNA, and tRNA genes were similar to other Passeriformes in gene arrangement and composition. In 13 PCGs, 12 were initiated with ATG, only COI was GTG, and stopped by five types of stop codons. We constructed a phylogenetic tree based on 13 PCGs of G. affinis and other nine Timaliidae species, found that the species belong to the same Passeriformes all cluster together.},
}

Animals
Base Composition
DNA, Ribosomal/genetics
Gene Order
Genome Size
*Genome, Mitochondrial
Mitochondria/*genetics
Passeriformes/*genetics
Phylogeny
RNA, Transfer/genetics
Sequence Analysis, DNA/*methods

@article {pmid26681479,
year = {2017},
author = {Chen, X and Chen, Y and Yu, M and Sha, Z and Shan, X},
title = {The complete mitochondrial genome of the Azuma emmnion.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {28},
number = {1},
pages = {77-78},
doi = {10.3109/19401736.2015.1110806},
pmid = {26681479},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Base Sequence ; DNA, Mitochondrial ; *Genes, Mitochondrial ; Genome Size ; *Genome, Mitochondrial ; Genomics ; Perciformes/*genetics ; *Phylogeny ; Sequence Analysis, DNA ; },
abstract = {The complete mitochondrial genome of the Azuma emmnion has been determined. The total length of a complete nucleotide sequence of the mitochondria is 16 522 bp, which contained 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes, and one D-loop region. Its nucleotide sequence and composition of A. emmnion mitochondrion was similar to most other vertebrates. Nucleotide base composition of mitochondrial genome was the following: 25.58% for A, 18.22% for G, 27.67% for C, 28.53% for T. The phylogenetic analysis result, which based on the complete mitogenomes of of A. emmnion and other 11 fish species, indicated that A. emmnion and Pholis crassispina clustered into one branch.},
}

Animals
Base Composition
Base Sequence
DNA, Mitochondrial
*Genes, Mitochondrial
Genome Size
*Genome, Mitochondrial
Genomics
Perciformes/*genetics
*Phylogeny
Sequence Analysis, DNA

@article {pmid26703096,
year = {2016},
author = {Konovalova, O and Logacheva, M},
title = {Mitochondrial genome of two marine fungal species.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {27},
number = {6},
pages = {4280-4281},
doi = {10.3109/19401736.2015.1082094},
pmid = {26703096},
issn = {2470-1408},
mesh = {Acremonium/*genetics ; Base Composition/genetics ; Base Sequence/genetics ; Conserved Sequence/genetics ; DNA, Mitochondrial/*genetics ; Gene Order/genetics ; Genes, Mitochondrial/genetics ; Genome ; Genome, Fungal/genetics ; Genome, Mitochondrial/*genetics ; Mitochondria/genetics ; Phylogeny ; Sequence Analysis, DNA/methods ; },
abstract = {Here is a first record for a mitochondrial genome of marine fungus Acremonium fuci and closely related species Emericellopsis sp. One strain for each species, differentiated by morphological features was studied. Complete mitochondrial sequences are 24 565 and 24 951 bp in length. The circular molecule encodes all genes typical for fungal mitochondrial genomes: 15 protein-coding genes, 28 tRNAs, and large and small subunits of RNA. All structural genes are located on one strand and transcribed in one direction. Mitogenomes of species have 99% identity in protein-coding genes, but differ in some structural features: one of them has additional ORF with a similarity to cox1 gene, and another one has an intron in nad5 gene.},
}

Acremonium/*genetics
Base Composition/genetics
Base Sequence/genetics
Conserved Sequence/genetics
DNA, Mitochondrial/*genetics
Gene Order/genetics
Genes, Mitochondrial/genetics
Genome
Genome, Fungal/genetics
Genome, Mitochondrial/*genetics
Mitochondria/genetics
Phylogeny
Sequence Analysis, DNA/methods

@article {pmid26708415,
year = {2016},
author = {Lütz-Meindl, U and Luckner, M and Andosch, A and Wanner, G},
title = {Structural stress responses and degradation of dictyosomes in algae analysed by TEM and FIB-SEM tomography.},
journal = {Journal of microscopy},
volume = {263},
number = {2},
pages = {129-141},
doi = {10.1111/jmi.12369},
pmid = {26708415},
issn = {1365-2818},
mesh = {Endoplasmic Reticulum/metabolism ; Golgi Apparatus/*metabolism ; Imaging, Three-Dimensional ; Micrasterias/*cytology/metabolism/*ultrastructure ; Microscopy, Electron ; Phylogeny ; Tomography, X-Ray Computed ; },
abstract = {Stress-induced physiological deficiencies in cells are reflected in structural, morphological and functional reactions of organelles. Although numerous investigations have focused on chloroplasts and mitochondria as main targets of different stressors in plant cells, there is insufficient information on the plant Golgi apparatus as stress sensor. By using the advantages of field emission scanning electron microscopy tomography in combination with classical ultrathin sectioning and transmission electron microscopic analyses, we provide structural evidence for common stress responses of the large and highly stable dictyosomes in the algal model system Micrasterias. Stress is induced by different metals such as manganese and lead, by starvation in 9 weeks of darkness or by inhibiting photosynthesis or glycolysis and by disturbing ionic homeostasis via KCl. For the first time a stress-induced degradation pathway of dictyosomes is described that does not follow "classical" autophagy but occurs by disintegration of cisternae into single membrane balls that seem to be finally absorbed by the endoplasmic reticulum (ER). Comparison of the morphological features that accompany dictyosomal degradation in Micrasterias to similar reactions observed during the same stress application in Nitella indicates an ubiquitous degradation process at least in algae. As the algae investigated belong to the closest relatives of higher land plants these results may also be relevant for understanding dictyosomal stress and degradation responses in the latter phylogenetic group. In addition, this study shows that two-dimensional transmission electron microscopy is insufficient for elucidating complex processes such as organelle degradation, and that information from three-dimensional reconstructions as provided by field emission scanning electron microscopy tomography is absolutely required for a comprehensive understanding of the phenomenon.},
}

Endoplasmic Reticulum/metabolism
Golgi Apparatus/*metabolism
Imaging, Three-Dimensional
Micrasterias/*cytology/metabolism/*ultrastructure
Microscopy, Electron
Phylogeny
Tomography, X-Ray Computed

@article {pmid26709737,
year = {2017},
author = {Guo, C and Zhang, Q and Huang, Y},
title = {The complete mitochondrial genome of the Oedaleus infernalis sauss (Orthoptera: Oedipodidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {28},
number = {1},
pages = {89-90},
doi = {10.3109/19401736.2015.1110812},
pmid = {26709737},
issn = {2470-1408},
mesh = {Animals ; Base Sequence ; China ; Codon ; DNA, Mitochondrial ; Gene Order ; *Genes, Mitochondrial ; Genome Size ; Genome, Insect ; *Genome, Mitochondrial ; Genomics ; Grasshoppers/*genetics ; *Phylogeny ; Sequence Analysis, DNA ; },
abstract = {The Oedaleus infernalis sauss (Orthoptera: Oedipodidae) is one of the main pests at the rice production area in China, and they mainly feed on leaves and grain of rice. The mitogenome was 15 898 bp long and composed of 13 protein-coding genes, 22 tRNA genes, two rRNA genes, and one putative control region. Most protein-coding genes started with a traditional ATN codon, and terminated with the mitochondria stop codon (TAA/TAG) or a single T-- base. The average A + T content of the O. infernalis sauss mitochondrial genome protein-coding sequence, rRNA, tRNA gene, and A + T-rich region was corresponding well to the A + T bias generally observed in insect mitochondrial genomes. Using the 12 protein-coding genes of O. infernalis sauss in this study, together with 15 other closely species, a preliminary phylogenetic analysis has been carried out.},
}

Animals
Base Sequence
China
Codon
DNA, Mitochondrial
Gene Order
*Genes, Mitochondrial
Genome Size
Genome, Insect
*Genome, Mitochondrial
Genomics
Grasshoppers/*genetics
*Phylogeny
Sequence Analysis, DNA

@article {pmid26710601,
year = {2015},
author = {Zhang, Y and Guo, L and Zhang, S and Liu, X},
title = {[Determining mitochondrial molecular markers suitable for genetic diversity analysis of Cordyceps militaris].},
journal = {Wei sheng wu xue bao = Acta microbiologica Sinica},
volume = {55},
number = {7},
pages = {826-833},
pmid = {26710601},
issn = {0001-6209},
mesh = {Biomarkers/analysis ; Cordyceps/classification/*genetics/isolation & purification ; Fungal Proteins/genetics ; *Genetic Variation ; Mitochondria/*genetics ; Phylogeny ; },
abstract = {OBJECTIVE: To screen efficient molecular markers suitable for genetic diversity analysis of Cordyceps militaris from mitochondrial DNA.

METHODS: We amplified 12 mitochondrial DNA fragments and 3 nuclear DNA fragments from each of 20 C. militaris isolates and analyzed nucleotide variations on these DNA fragments.

RESULTS: We revealed a greatly higher genetic variation in mitochondrial DNA fragments than in nuclear DNA fragments. Specifically, C. militaris isolates exhibited intron presence/absence diversity in some mitochondrial fragments, and more variable sites were found in mitochondrial fragments than in nuclear fragments. The extent of nucleotide variations also varied by mitochondrial fragment, and intronic proteins seemed to be more vulnerable to amino acid changes than exonic proteins. Genetic diversity increased with the number of molecular markers used.

CONCLUSION: We recommended using (in order) nad3-cox2. cox2-nad5, cox2, cox3, cob, and cox1 for future genetic diversity and population genetic studies of C. militaris.},
}

Biomarkers/analysis
Cordyceps/classification/*genetics/isolation & purification
Fungal Proteins/genetics
*Genetic Variation
Mitochondria/*genetics
Phylogeny

@article {pmid26710828,
year = {2017},
author = {Liu, Y and Jiang, L},
title = {The complete mitochondrial genome sequence of the Himalayan goral, Naemorhedus goral (Cetartiodactyla: Caprinae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {28},
number = {2},
pages = {233-235},
doi = {10.3109/19401736.2015.1115856},
pmid = {26710828},
issn = {2470-1408},
mesh = {Animals ; DNA, Mitochondrial/genetics ; Genes, Mitochondrial ; *Genome, Mitochondrial ; Mitochondria/genetics ; Mitochondrial Proteins/genetics ; Phylogeny ; RNA, Ribosomal/genetics ; RNA, Transfer/genetics ; Ruminants/*genetics ; },
abstract = {The Himalayan goral (Naemorhedus goral) belongs to the subfamily Caprinae, which is distributed across the Himalayas including Bhutan, northern India including Sikkim and Arunachal Pradesh, Nepal, southern Tibet, and possibly western Myanmar. In this study, the complete mitochondrial genome of N. goral was sequenced. The mitogenome was 16 533 bp in length, consisting of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and a non-coding control region. As in other mammals, most mitochondrial genes are encoded on the heavy strand, except for ND6 and eight tRNA genes which are encoded on the light strand. The overall base composition of the N. goral is 33.7% A, 27.2% T, 26.0% C, and 13.1% G. Phylogenetic analysis based on the mitogenome sequences using the Bayesian inferences method showed that Naemorhedus and Capricornis formed a monophyletic group and the N. goral was closely related to N. griseus. We expect that the present results will facilitate further investigation of the phylogenetic relationships and population genetics of genus Naemorhedus.},
}

Animals
DNA, Mitochondrial/genetics
Genes, Mitochondrial
*Genome, Mitochondrial
Mitochondria/genetics
Mitochondrial Proteins/genetics
Phylogeny
RNA, Ribosomal/genetics
RNA, Transfer/genetics
Ruminants/*genetics

@article {pmid26710999,
year = {2017},
author = {Jiang, L and Zhao, L and Liu, Y and Leng, Z and Zhao, L and Ruan, Q},
title = {The complete mitochondrial genome sequence of the Dark-spotted frog Pelophylax nigromaculatus (Amphibia, Anura, Ranidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {28},
number = {2},
pages = {236-237},
doi = {10.3109/19401736.2015.1115857},
pmid = {26710999},
issn = {2470-1408},
mesh = {Amphibian Proteins/genetics ; Animals ; China ; DNA, Mitochondrial/genetics ; Asia, Eastern ; Genes, Mitochondrial ; *Genome, Mitochondrial ; Mitochondria/genetics ; Mitochondrial Proteins/genetics ; Phylogeny ; Phylogeography ; RNA, Ribosomal/genetics ; RNA, Transfer/genetics ; Ranidae/*genetics ; Russia ; },
abstract = {The dark-spotted frog (Pelophylax nigromaculatus) belongs to Ranidae. This species is known from the Russian Far East, central, northern and north-eastern China, the Democratic People's Republic of Korea, the Republic of Korea, and Japan. In this study, the complete mitochondrial genome of P. nigromaculatus was sequenced. The mitogenome was 17 567 bp in length, consisting of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, 2 ribosomal RNA (rRNA) genes, and a non-coding control region. As in other vertebrates, most mitochondrial genes are encoded on the heavy strand, except for ND6 and eight tRNA genes which are encoded on the light strand. The overall base composition of the P. nigromaculatus is 29.2% A, 27.4% T, 28.4% C, and 15.0% G. Phylogenetic analysis showed P. nigromaculatus was closely related to P. plancyi and P. chosenicus. The complete mitogenome of P. nigromaculatus can provide important data for the studies on phylogenetic relationship and population genetics to further explore the taxonomic status of this species.},
}

Amphibian Proteins/genetics
Animals
China
DNA, Mitochondrial/genetics
Asia, Eastern
Genes, Mitochondrial
*Genome, Mitochondrial
Mitochondria/genetics
Mitochondrial Proteins/genetics
Phylogeny
Phylogeography
RNA, Ribosomal/genetics
RNA, Transfer/genetics
Ranidae/*genetics
Russia

@article {pmid26713709,
year = {2017},
author = {Wang, P and Chen, S and Ou, Y and Wen, J and Li, J},
title = {Complete mitochondrial genome of Toxabramis houdemeri (Cypriniformes; Cyprinidae) and its phylogenetic analysis.},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {28},
number = {2},
pages = {292-293},
doi = {10.3109/19401736.2015.1118085},
pmid = {26713709},
issn = {2470-1408},
mesh = {Animals ; Cyprinidae/*genetics ; Fish Proteins/genetics ; Genes, Mitochondrial ; Genes, rRNA ; *Genome, Mitochondrial ; Mitochondria/genetics ; Mitochondrial Proteins/genetics ; *Phylogeny ; RNA, Transfer/genetics ; },
abstract = {Toxabramis houdemeri belongs to the genus Toxabramis in the subfamily of Cultrinae (Cyprinidae). We first determine the complete mitochondrial genome of T. houdemeri in this study. It is 16 618 bp in length, with the base composition on the heavy strand: 30.79% A, 16.61% G, 27.29% C, and 25.31% T. It has the typical vertebrate mitochondrial gene arrangement, including 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and a D-loop region. Phylogenetic analysis showed that T. houdemeri was clustered into one branch of the subfamily of Cultrinae, and closely related to Hemiculter leucisculus. The present study will contribute to genetic resources conservation of T. houdemeri and studying its population genetic structure and phylogenetic relationships.},
}

Animals
Cyprinidae/*genetics
Fish Proteins/genetics
Genes, Mitochondrial
Genes, rRNA
*Genome, Mitochondrial
Mitochondria/genetics
Mitochondrial Proteins/genetics
*Phylogeny
RNA, Transfer/genetics

@article {pmid26713710,
year = {2017},
author = {Urantowka, AD and Mackiewicz, P},
title = {Complete mitochondrial genome of Blue-winged Macaw (Primolius maracana).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {28},
number = {2},
pages = {275-276},
doi = {10.3109/19401736.2015.1118077},
pmid = {26713710},
issn = {2470-1408},
mesh = {Animals ; Body Size ; *Genome, Mitochondrial ; Mitochondria/genetics ; Parrots/anatomy & histology/*genetics ; *Phylogeny ; },
abstract = {abtract The presence of bare facial area distinguishes Macaws from other members of the Arini tribe. Genera and species of the Macaw group differ in pattern of this bare skin as well as in body size. Individuals of the genera: Diopsittaca, Orthopsittaca, and Primolius are significantly smaller than the members of the genera: Anodorhynchus, Cyanopsitta, and the most species of the genus Ara. The genus Primolius contains three species: P. auricollis, P. couloni, and P. maracana, which are classified as medium-sized Macaws. So far, mitochondrial genome representative for the genus was sequenced only for Primolius couloni species. Primolius maracana mitogenome, which was sequenced in this study, will be indispensable to refine the phylogenetic relationships between Primolius species, as results of molecular researches seems to be inconsistent with Primolius species morphology.},
}

Animals
Body Size
*Genome, Mitochondrial
Mitochondria/genetics
Parrots/anatomy & histology/*genetics
*Phylogeny

@article {pmid26713722,
year = {2017},
author = {Jebb, D and Foley, NM and Puechmaille, SJ and Teeling, EC},
title = {The complete mitochondrial genome of the Greater Mouse-Eared bat, Myotis myotis (Chiroptera: Vespertilionidae).},
journal = {Mitochondrial DNA. Part A, DNA mapping, sequencing, and analysis},
volume = {28},
number = {3},
pages = {347-349},
doi = {10.3109/19401736.2015.1122775},
pmid = {26713722},
issn = {2470-1408},
mesh = {Animals ; Base Composition ; Base Sequence ; Chiroptera/*genetics ; DNA, Mitochondrial ; *Genes, Mitochondrial ; Genome Size ; *Genome, Mitochondrial ; *Phylogeny ; Sequence Analysis, DNA ; },
abstract = {In this study, we report the complete mitochondrial genome of the Greater Mouse-Eared Bat, Myotis myotis. The mitogenome is 17 213 bp with base composition A (34.2%), G (13%), C (22.4%), and T (30.5%). The genome shows conserved synteny with other mammalian mitogenomes, containing 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes, and 1 control region (D-Loop). The majority of the genes are encoded on the H-Strand, except for ND6 and eight tRNAs. All protein-coding genes start with the ATG start codon, except for ND2, ND3, and ND5 which begin with ATT or ATA. Seven protein-coding genes terminated in a canonical stop codon, TAA or TAG, five contain incomplete stop codons, T or TA. Cytochrome b terminates in the mitochondria specific stop codon AGA. This mitogenome provides a valuable resource for future studies of M. myotis and other bat and mammal species.},
}

Animals
Base Composition
Base Sequence
Chiroptera/*genetics
DNA, Mitochondrial
*Genes, Mitochondrial
Genome Size
*Genome, Mitochondrial
*Phylogeny
Sequence Analysis, DNA

@article {pmid26720602,
year = {2015},
author = {Ye, YY and Wu, CW and Li, JJ},
title = {Genetic Population Structure of Macridiscus multifarius (Mollusca: Bivalvia) on the Basis of Mitochondrial Markers: Strong Population Structure in a Species with a Short Planktonic Larval Stage.},
journal = {PloS one},
volume = {10},
number = {12},
pages = {e0146260},
pmid = {26720602},
issn = {1932-6203},
mesh = {Animals ; Bivalvia/*genetics ; China ; DNA, Mitochondrial/genetics ; Demography/methods ; Fisheries ; Genetic Drift ; Genetic Markers/*genetics/*immunology/*physiology ; Genetic Variation/genetics ; Genetics, Population/methods ; Geography/methods ; Haplotypes/genetics ; Larva/*genetics ; Mitochondria/*genetics ; Mollusca/*genetics ; Plankton/*genetics ; RNA, Ribosomal/genetics ; Sequence Analysis, DNA/methods ; },
abstract = {The clam Macridiscus multifarius with a planktonic larval stage of about 10 days is an ecologically and economically important species in the coastal regions of China. In this study, 3 mt-DNA markers (COI, 12S rRNA, and ND1) were used to investigate the population structure and demography of wild M. multifarius populations in 3 coastal localities of the East China Sea (ZS and ZP populations) and Beibu Gulf in the South China Sea (BH population). Sequences of 685 bp in COI, 350 bp in 12S rRNA, and 496 bp in ND1 were determined. High level and significant FST values were obtained among the different localities on the basis of either COI (FST = 0.100-0.444, p < 0.05) or 12S rRNA (FST = 0.199-0.742, p < 0.05) gene, indicating a high degree of genetic differentiation among the populations. FST values were significant but weak for the ND1 gene because it is highly conservative. The median-joining network suggested an obvious genetic differentiation between ZS and BH populations, and the finding is consistent with the results of our demographic analyses using the unweighted pair group method with arithmetic mean. Our study unraveled the extant population genetic structure of M. multifarius and explained the strong population structure of a species with a short planktonic larval stage species; this information could be useful for fishery management measures, including artificial breeding and conservation.},
}

Animals
Bivalvia/*genetics
China
DNA, Mitochondrial/genetics
Demography/methods
Fisheries
Genetic Drift
Genetic Markers/*genetics/*immunology/*physiology
Genetic Variation/genetics
Genetics, Population/methods
Geography/methods
Haplotypes/genetics
Larva/*genetics
Mitochondria/*genetics
Mollusca/*genetics
Plankton/*genetics
RNA, Ribosomal/genetics
Sequence Analysis, DNA/methods

@article {pmid26752183,
year = {2016},
author = {Mallela, SK and Almeida, R and Ejsing, CS and Conzelmann, A},
title = {Functions of Ceramide Synthase Paralogs YPR114w and YJR116w of Saccharomyces cerevisiae.},
journal = {PloS one},
volume = {11},
number = {1},
pages = {e0145831},
pmid = {26752183},
issn = {1932-6203},
mesh = {Acetylcysteine/pharmacology ; Alkaline Ceramidase/genetics/metabolism ; Amidohydrolases/genetics/metabolism ; Antifungal Agents/pharmacology ; Antioxidants/pharmacology ; Cations, Divalent ; Ceramides/*biosynthesis ; Copper/toxicity ; Fatty Acids, Monounsaturated/pharmacology ; Gene Deletion ; *Gene Expression Regulation, Fungal ; Membrane Proteins/genetics/metabolism ; Mitochondria/metabolism ; Oxidoreductases/genetics/metabolism ; Oxygen/pharmacology ; Phylogeny ; Reactive Oxygen Species/metabolism ; Saccharomyces cerevisiae/classification/drug effects/*genetics/metabolism ; Saccharomyces cerevisiae Proteins/*genetics/metabolism ; Vacuoles/metabolism ; },
abstract = {Ceramide is synthesized in yeast by two redundant acyl-CoA dependent synthases, Lag1 and Lac1. In lag1∆ lac1∆ cells, free fatty acids and sphingoid bases are elevated, and ceramides are produced through the redundant alkaline ceramidases Ypc1 and Ydc1, working backwards. Even with all four of these genes deleted, cells are surviving and continue to contain small amounts of complex sphingolipids. Here we show that these residual sphingolipids are not synthesized by YPR114w or YJR116w, proteins of unknown function showing a high degree of homology to Lag1 and Lac1. Indeed, the hextuple lag1∆ lac1∆ ypc1∆ ydc1∆ ypr114w∆ yjr116w∆ mutant still contains ceramides and complex sphingolipids. Yjr116w∆ exhibit an oxygen-dependent hypersensitivity to Cu2+ due to an increased mitochondrial production of reactive oxygen species (ROS) and a mitochondrially orchestrated programmed cell death in presence of copper, but also a general copper hypersensitivity that cannot be counteracted by the antioxidant N-acetyl-cysteine (NAC). Myriocin efficiently represses the synthesis of sphingoid bases of ypr114w∆, but not its growth. Both yjr116w∆ and ypr114w∆ have fragmented vacuoles and produce less ROS than wild type, before and after diauxic shift. Ypr114w∆/ypr114w∆ have an increased chronological life span. Thus, Yjr116w and Ypr114w are related, but not functionally redundant.},
}

Acetylcysteine/pharmacology
Alkaline Ceramidase/genetics/metabolism
Amidohydrolases/genetics/metabolism
Antifungal Agents/pharmacology
Antioxidants/pharmacology
Cations, Divalent
Ceramides/*biosynthesis
Copper/toxicity
Fatty Acids, Monounsaturated/pharmacology
Gene Deletion
*Gene Expression Regulation, Fungal
Membrane Proteins/genetics/metabolism
Mitochondria/metabolism
Oxidoreductases/genetics/metabolism
Oxygen/pharmacology
Phylogeny
Reactive Oxygen Species/metabolism
Saccharomyces cerevisiae/classification/drug effects/*genetics/metabolism
Saccharomyces cerevisiae Proteins/*genetics/metabolism
Vacuoles/metabolism

@article {pmid26776396,
year = {2016},
author = {Patra, AK and Kwon, YM and Kang, SG and Fujiwara, Y and Kim, SJ},
title = {The complete mitochondrial genome sequence of the tubeworm Lamellibrachia satsuma and structural conservation in the mitochondrial genome control regions of Order Sabellida.},
journal = {Marine genomics},
volume = {26},
number = {},
pages = {63-71},
doi = {10.1016/j.margen.2015.12.010},
pmid = {26776396},
issn = {1876-7478},
mesh = {Animals ; Base Sequence ; Codon ; DNA/genetics ; Gene Expression Regulation/*physiology ; Genome, Mitochondrial/*genetics ; Phylogeny ; Polychaeta/classification/*genetics ; RNA, Ribosomal/genetics ; RNA, Transfer/genetics ; },
abstract = {The control region of the mitochondrial genomes shows high variation in conserved sequence organizations, which follow distinct evolutionary patterns in different species or taxa. In this study, we sequenced the complete mitochondrial genome of Lamellibrachia satsuma from the cold-seep region of Kagoshima Bay, as a part of whole genome study and extensively studied the structural features and patterns of the control region sequences. We obtained 15,037 bp of mitochondrial genome using Illumina sequencing and identified the non-coding AT-rich region or control region (354 bp, AT=83.9%) located between trnH and trnR. We found 7 conserved sequence blocks (CSB), scattered throughout the control region of L. satsuma and other taxa of Annelida. The poly-TA stretches, which commonly form the stem of multiple stem-loop structures, are most conserved in the CSB-I and CSB-II regions. The mitochondrial genome of L. satsuma encodes a unique repetitive sequence in the control region, which forms a unique secondary structure in comparison to Lamellibrachia luymesi. Phylogenetic analyses of all protein-coding genes indicate that L. satsuma forms a monophyletic clade with L. luymesi along with other tubeworms found in cold-seep regions (genera: Lamellibrachia, Escarpia, and Seepiophila). In general, the control region sequences of Annelida could be aligned with certainty within each genus, and to some extent within the family, but with a higher rate of variation in conserved regions.},
}

Animals
Base Sequence
Codon
DNA/genetics
Gene Expression Regulation/*physiology
Genome, Mitochondrial/*genetics
Phylogeny
Polychaeta/classification/*genetics
RNA, Ribosomal/genetics
RNA, Transfer/genetics

@article {pmid26782414,
year = {2015},
author = {Yin, SL and Lan, C and Pei, H and Zhu, ZQ},
title = {Mitochondrial transfer RNA mutations and hypertension.},
journal = {Genetics and molecular research : GMR},
volume = {14},
number = {4},
pages = {17692-17698},
doi = {10.4238/2015.December.21.42},
pmid = {26782414},
issn = {1676-5680},
mesh = {DNA, Mitochondrial/*genetics ; Humans ; Hypertension/*genetics/pathology ; Mitochondria/genetics ; Mutation ; *Phylogeny ; Polymorphism, Genetic ; RNA, Transfer/*genetics ; },
abstract = {Mutations in mitochondrial DNA have been found to be associated with hypertension. Of these, mitochondrial transfer RNA (mt-tRNA) is a hot spot for these pathogenic mutations. It is generally believed that these mutations may result in the failure of mt-tRNA metabolism, thereby worsening mitochondrial dysfunction and resulting in hypertension. mt-tRNA is known for its high frequency of polymorphisms and mutations, and the number of reports regarding mt-tRNA mutations and hypertension is increasing significantly. To better understand the molecular basis of maternally inherited hypertension, we reassessed the link between four mt-tRNA mutations (G15927A in tRNA(Thr), C7492T in tRNA(Ser(UCN)), A4386G in tRNA(Gln), and C14686T in tRNA(Glu)) and hypertension. We first used the phylogenetic approach to investigate the deleterious roles of these mutations, then we used RNA Fold Web Server to predict the minimum free energy of these mt-tRNAs with and without mutations. Using the pathogenicity scoring system, we found that the G15927A and C7492T mutations are classified as pathogenic while all other studied mutations are neutral polymorphisms. Our study provides valuable information for the detection of pathogenic mt-tRNA mutations in hypertension.},
}

DNA, Mitochondrial/*genetics
Humans
Hypertension/*genetics/pathology
Mitochondria/genetics
Mutation
*Phylogeny
Polymorphism, Genetic
RNA, Transfer/*genetics

@article {pmid26787157,
year = {2016},
author = {Teves, SC and Gardim, S and Carbajal de la Fuente, AL and Lopes, CM and Gonçalves, TC and dos Santos Mallet, JR and da Rosa, JA and Almeida, CE},
title = {Mitochondrial Genes Reveal Triatoma jatai as a Sister Species to Triatoma costalimai (Reduviidae: Triatominae).},
journal = {The American journal of tropical medicine and hygiene},
volume = {94},
number = {3},
pages = {686-688},
pmid = {26787157},
issn = {1476-1645},
mesh = {Animals ; Bayes Theorem ; Genetic Speciation ; Mitochondria/*genetics ; Phylogeny ; Species Specificity ; Triatoma/*genetics ; },
abstract = {Triatoma jatai was described using a set of morphological structures from specimens collected in Paranã municipality of Tocantins State, Brazil. Under a Bayesian framework and using two mitochondrial genes (16S and COI), phylogenetic analysis recovered T. jatai as a sister species to Triatoma costalimai with higher genetic distances than between other well-recognized species. Our results agree with previous suggestions based on morphometric analysis. In the light of the non-monophyly of Matogrossensis subcomplex, the inclusion of T. jatai shall be considered for reevaluating this group.},
}

Animals
Bayes Theorem
Genetic Speciation
Mitochondria/*genetics
Phylogeny
Species Specificity
Triatoma/*genetics

@article {pmid26794804,
year = {2016},
author = {Nývltová, E and Smutná, T and Tachezy, J and Hrdý, I},
title = {OsmC and incomplete glycine decarboxylase complex mediate reductive detoxification of peroxides in hydrogenosomes of Trichomonas vaginalis.},
journal = {Molecular and biochemical parasitology},
volume = {206},
number = {1-2},
pages = {29-38},
doi = {10.1016/j.molbiopara.2016.01.006},
pmid = {26794804},
issn = {1872-9428},
mesh = {Amino Acid Sequence ; Axenic Culture ; Cloning, Molecular ; Escherichia coli/genetics/metabolism ; Gene Expression ; Glycine Decarboxylase Complex/genetics/*metabolism ; Hydrogen Peroxide/*metabolism ; Kinetics ; Metabolic Detoxication, Phase I/genetics ; Mitochondria/*metabolism/ultrastructure ; Oxidation-Reduction ; Peroxidases/genetics/*metabolism ; Phylogeny ; Protein Binding ; Protozoan Proteins/genetics/*metabolism ; Recombinant Proteins/genetics/metabolism ; Sequence Alignment ; Sequence Homology, Amino Acid ; Trichomonas vaginalis/genetics/*metabolism/ultrastructure ; },
abstract = {Osmotically inducible protein (OsmC) and organic hydroperoxide resistance protein (Ohr) are small, thiol-dependent peroxidases that comprise a family of prokaryotic protective proteins central to the defense against deleterious effects of organic hydroperoxides, which are reactive molecules that are formed during interactions between the host immune system and pathogens. Trichomonas vaginalis, a sexually transmitted parasite of humans, possesses OsmC homologues in its hydrogenosomes, anaerobic mitochondrial organelles that harbor enzymes and pathways that are sensitive to oxidative damage. The glycine decarboxylase complex (GDC), which consists of four proteins (i.e., L, H, P and T), is in eukaryotes exclusively mitochondrial enzymatic system that catalyzes oxidative decarboxylation and deamination of glycine. However, trichomonad hydrogenosomes contain only the L and H proteins, whose physiological functions are unknown. Here, we found that the hydrogenosomal L and H proteins constitute a lipoate-dependent redox system that delivers electrons from reduced nicotinamide adenine dinucleotide (NADH) to OsmC for the reductive detoxification of peroxides. Our searches of genome databases revealed that, in addition to prokaryotes, homologues of OsmC/Ohr family proteins with predicted mitochondrial localization are present in various eukaryotic lineages. Therefore, we propose that the novel OsmC-GDC-based redox system may not be limited to T. vaginalis.},
}

Amino Acid Sequence
Axenic Culture
Cloning, Molecular
Escherichia coli/genetics/metabolism
Gene Expression
Glycine Decarboxylase Complex/genetics/*metabolism
Hydrogen Peroxide/*metabolism
Kinetics
Metabolic Detoxication, Phase I/genetics
Mitochondria/*metabolism/ultrastructure
Oxidation-Reduction
Peroxidases/genetics/*metabolism
Phylogeny
Protein Binding
Protozoan Proteins/genetics/*metabolism
Recombinant Proteins/genetics/metabolism
Sequence Alignment
Sequence Homology, Amino Acid
Trichomonas vaginalis/genetics/*metabolism/ultrastructure

@article {pmid26800039,
year = {2016},
author = {Kersten, B and Faivre Rampant, P and Mader, M and Le Paslier, MC and Bounon, R and Berard, A and Vettori, C and Schroeder, H and Leplé, JC and Fladung, M},
title = {Genome Sequences of Populus tremula Chloroplast and Mitochondrion: Implications for Holistic Poplar Breeding.},
journal = {PloS one},
volume = {11},
number = {1},
pages = {e0147209},
pmid = {26800039},
issn = {1932-6203},
mesh = {Chloroplasts/*genetics ; *Genome, Plant ; Mitochondria/*genetics ; Phylogeny ; *Plant Breeding ; Populus/classification/*genetics ; },
abstract = {Complete Populus genome sequences are available for the nucleus (P. trichocarpa; section Tacamahaca) and for chloroplasts (seven species), but not for mitochondria. Here, we provide the complete genome sequences of the chloroplast and the mitochondrion for the clones P. tremula W52 and P. tremula x P. alba 717-1B4 (section Populus). The organization of the chloroplast genomes of both Populus clones is described. A phylogenetic tree constructed from all available complete chloroplast DNA sequences of Populus was not congruent with the assignment of the related species to different Populus sections. In total, 3,024 variable nucleotide positions were identified among all compared Populus chloroplast DNA sequences. The 5-prime part of the LSC from trnH to atpA showed the highest frequency of variations. The variable positions included 163 positions with SNPs allowing for differentiating the two clones with P. tremula chloroplast genomes (W52, 717-1B4) from the other seven Populus individuals. These potential P. tremula-specific SNPs were displayed as a whole-plastome barcode on the P. tremula W52 chloroplast DNA sequence. Three of these SNPs and one InDel in the trnH-psbA linker were successfully validated by Sanger sequencing in an extended set of Populus individuals. The complete mitochondrial genome sequence of P. tremula is the first in the family of Salicaceae. The mitochondrial genomes of the two clones are 783,442 bp (W52) and 783,513 bp (717-1B4) in size, structurally very similar and organized as single circles. DNA sequence regions with high similarity to the W52 chloroplast sequence account for about 2% of the W52 mitochondrial genome. The mean SNP frequency was found to be nearly six fold higher in the chloroplast than in the mitochondrial genome when comparing 717-1B4 with W52. The availability of the genomic information of all three DNA-containing cell organelles will allow a holistic approach in poplar molecular breeding in the future.},
}

Chloroplasts/*genetics
*Genome, Plant
Mitochondria/*genetics
Phylogeny
*Plant Breeding
Populus/classification/*genetics

@article {pmid26809915,
year = {2015},
author = {Esmaelizad, M and Zeinedin, H and Razmaraii, N and Mirjalili, A},
title = {Molecular Study of the G1 Haplotypes of Echinococcus granulosus from Iran Based on Cytochrome C Oxidase (Subunit 1) Sequence.},
journal = {Turkiye parazitolojii dergisi},
volume = {39},
number = {4},
pages = {286-290},
doi = {10.5152/tpd.2015.4292},
pmid = {26809915},
issn = {2146-3077},
mesh = {Animals ; Base Sequence ; Cytochromes c1/chemistry/*genetics ; DNA, Helminth/chemistry/isolation & purification ; Echinococcosis, Hepatic/parasitology/*veterinary ; Echinococcus granulosus/*classification/genetics/isolation & purification ; Electron Transport Complex IV/*genetics ; Genotype ; Genotyping Techniques ; Goat Diseases/*parasitology ; Goats ; Haplotypes ; Iran ; Mitochondria/enzymology ; Phylogeny ; Polymerase Chain Reaction ; Polymorphism, Genetic ; Sequence Alignment ; Sheep ; Sheep Diseases/*parasitology ; },
abstract = {OBJECTIVE: In this study, we attempted to identify new Echinococcus granulosus isolates in the North West provinces of Iran based on the mitochondrial cytochrome c oxidase subunit 1 (CO1) sequence.

METHODS: Twenty-nine hydatid cysts from sheep and goats were collected. Genomic DNAs were extracted, and a partial sequence of the CO1 gene was amplified. Polymerase chain reaction products were cloned and sequenced with M13 primers in both directions.

RESULTS: All Iranian isolates were located in G1 and G3 genotypes. For the first time, a new G1 haplotype in two Iranian isolates were identified.

CONCLUSION: It seems that this new haplotype was transmitted from Jordan to Iran or vice versa.},
}

Animals
Base Sequence
Cytochromes c1/chemistry/*genetics
DNA, Helminth/chemistry/isolation & purification
Echinococcosis, Hepatic/parasitology/*veterinary
Echinococcus granulosus/*classification/genetics/isolation & purification
Electron Transport Complex IV/*genetics
Genotype
Genotyping Techniques
Goat Diseases/*parasitology
Goats
Haplotypes
Iran
Mitochondria/enzymology
Phylogeny
Polymerase Chain Reaction
Polymorphism, Genetic
Sequence Alignment
Sheep
Sheep Diseases/*parasitology

@article {pmid26810560,
year = {2016},
author = {Ma, L and Dong, WW and Jiang, GF and Wang, X},
title = {The Complete Mitochondrial Genome of Brachmia macroscopa (Lepidoptera: Gelechiidae) and Its Related Phylogenetic Analysis.},
journal = {Journal of insect science (Online)},
volume = {16},
number = {1},
pages = {},
pmid = {26810560},
issn = {1536-2442},
mesh = {Animals ; Genome, Insect/*genetics ; Mitochondria/*genetics ; Moths/*genetics ; Phylogeny ; Polymerase Chain Reaction ; RNA, Ribosomal/genetics ; },
abstract = {The sweet potato leaf folder, Brachmia macroscopa, is an important pest in China. The complete mitogenome, which consists of 13 protein-coding genes (PCGs), 22 transfer RNA genes, two ribosomal RNA genes, and an A + T-rich region, was sequenced and found to be 15,394 bp in length (GeneBank no. KT354968). The gene order and orientation of the B. macroscopa mitogenome were similar to those of other sequenced lepidopteran species. All of the PCGs started with ATN as the canonical start codon except for cox1, which started with CGA. In regard to stop codons, most PCGs stopped at TAA except for cox2, which stopped at TA, and nad4, which stopped at a single T. Thirteen PCGs of the available species (33 taxa) were used to demonstrate phylogenetic relationships. The ditrysian cluster was supported as a monophyletic clade at high levels by using maximum likelihood and Bayesian methods. The apoditrysian group, covering the Gelechioidea, formed a monophyletic clade with a bootstrap value of 88% and a posterior probability of 1.00. The superfamily Gelechioidea was supported as a monophyletic lineage by a posterior probability of 1.00.},
}

Animals
Genome, Insect/*genetics
Mitochondria/*genetics
Moths/*genetics
Phylogeny
Polymerase Chain Reaction
RNA, Ribosomal/genetics

@article {pmid26840490,
year = {2016},
author = {Pittis, AA and Gabaldón, T},
title = {Late acquisition of mitochondria by a host with chimaeric prokaryotic ancestry.},
journal = {Nature},
volume = {531},
number = {7592},
pages = {101-104},
pmid = {26840490},
issn = {1476-4687},
support = {310325/ERC_/European Research Council/International ; },
mesh = {Eukaryotic Cells/*cytology/metabolism ; Genes, Bacterial/*genetics ; Genes, Mitochondrial/*genetics ; Genomics ; Mitochondria/*genetics/metabolism ; Mitochondrial Proteins/genetics/metabolism ; Models, Biological ; *Phylogeny ; Prokaryotic Cells/*cytology/metabolism ; Symbiosis/*genetics ; },
abstract = {The origin of eukaryotes stands as a major conundrum in biology. Current evidence indicates that the last eukaryotic common ancestor already possessed many eukaryotic hallmarks, including a complex subcellular organization. In addition, the lack of evolutionary intermediates challenges the elucidation of the relative order of emergence of eukaryotic traits. Mitochondria are ubiquitous organelles derived from an alphaproteobacterial endosymbiont. Different hypotheses disagree on whether mitochondria were acquired early or late during eukaryogenesis. Similarly, the nature and complexity of the receiving host are debated, with models ranging from a simple prokaryotic host to an already complex proto-eukaryote. Most competing scenarios can be roughly grouped into either mito-early, which consider the driving force of eukaryogenesis to be mitochondrial endosymbiosis into a simple host, or mito-late, which postulate that a significant complexity predated mitochondrial endosymbiosis. Here we provide evidence for late mitochondrial endosymbiosis. We use phylogenomics to directly test whether proto-mitochondrial proteins were acquired earlier or later than other proteins of the last eukaryotic common ancestor. We find that last eukaryotic common ancestor protein families of alphaproteobacterial ancestry and of mitochondrial localization show the shortest phylogenetic distances to their closest prokaryotic relatives, compared with proteins of different prokaryotic origin or cellular localization. Altogether, our results shed new light on a long-standing question and provide compelling support for the late acquisition of mitochondria into a host that already had a proteome of chimaeric phylogenetic origin. We argue that mitochondrial endosymbiosis was one of the ultimate steps in eukaryogenesis and that it provided the definitive selective advantage to mitochondria-bearing eukaryotes over less complex forms.},
}

Eukaryotic Cells/*cytology/metabolism
Genes, Bacterial/*genetics
Genes, Mitochondrial/*genetics
Genomics
Mitochondria/*genetics/metabolism
Mitochondrial Proteins/genetics/metabolism
Models, Biological
*Phylogeny
Prokaryotic Cells/*cytology/metabolism
Symbiosis/*genetics

@article {pmid26852331,
year = {2016},
author = {Buczek, D and Wojtkowska, M and Suzuki, Y and Sonobe, S and Nishigami, Y and Antoniewicz, M and Kmita, H and Makałowski, W},
title = {Protein import complexes in the mitochondrial outer membrane of Amoebozoa representatives.},
journal = {BMC genomics},
volume = {17},
number = {},
pages = {99},
pmid = {26852331},
issn = {1471-2164},
mesh = {Amino Acid Sequence ; Amoebozoa/classification/genetics/*metabolism ; Carrier Proteins/metabolism ; Conserved Sequence ; Exons ; Genetic Variation ; Genome, Protozoan ; Introns ; Mitochondrial Membranes/*metabolism ; Mitochondrial Precursor Protein Import Complex Proteins ; Multiprotein Complexes/*metabolism ; Phylogeny ; Protein Subunits ; Protein Transport ; Protozoan Proteins/chemistry/*metabolism ; Transcriptome ; },
abstract = {BACKGROUND: An ancestral trait of eukaryotic cells is the presence of mitochondria as an essential element for function and survival. Proper functioning of mitochondria depends on the import of nearly all proteins that is performed by complexes located in both mitochondrial membranes. The complexes have been proposed to contain subunits formed by proteins common to all eukaryotes and additional subunits regarded as lineage specific. Since Amoebozoa is poorly sampled for the complexes we investigated the outer membrane complexes, namely TOM, TOB/SAM and ERMES complexes, using available genome and transcriptome sequences, including transcriptomes assembled by us.

RESULTS: The results indicate differences in the organization of the Amoebozoa TOM, TOB/SAM and ERMES complexes, with the TOM complex appearing to be the most diverse. This is reflected by differences in the number of involved subunits and in similarities to the cognate proteins of representatives from different supergroups of eukaryotes.

CONCLUSIONS: The obtained results clearly demonstrate structural variability/diversity of these complexes in the Amoebozoa lineage and the reduction of their complexity as compared with the same complexes of model organisms.},
}

Amino Acid Sequence
Amoebozoa/classification/genetics/*metabolism
Carrier Proteins/metabolism
Conserved Sequence
Exons
Genetic Variation
Genome, Protozoan
Introns
Mitochondrial Membranes/*metabolism
Mitochondrial Precursor Protein Import Complex Proteins
Multiprotein Complexes/*metabolism
Phylogeny
Protein Subunits
Protein Transport
Protozoan Proteins/chemistry/*metabolism
Transcriptome

@article {pmid26876639,
year = {2016},
author = {Kornilios, P and Thanou, E and Kapli, P and Parmakelis, A and Chatzaki, M},
title = {Peeking through the trapdoor: Historical biogeography of the Aegean endemic spider Cyrtocarenum Ausserer, 1871 with an estimation of mtDNA substitution rates for Mygalomorphae.},
journal = {Molecular phylogenetics and evolution},
volume = {98},
number = {},
pages = {300-313},
doi = {10.1016/j.ympev.2016.01.021},
pmid = {26876639},
issn = {1095-9513},
mesh = {Animals ; Bayes Theorem ; Cell Nucleus/genetics ; Climate ; DNA, Mitochondrial/*genetics ; Greece ; Mitochondria/genetics ; *Mutation Rate ; *Phylogeny ; Phylogeography ; Spiders/*genetics ; Turkey ; },
abstract = {The Aegean region, located in the Eastern Mediterranean, is an area of rich biodiversity and endemism. Its position, geographical configuration and complex geological history have shaped the diversification history of many animal taxa. Mygalomorph spiders have drawn the attention of researchers, as excellent model systems for phylogeographical investigations. However, phylogeographic studies of spiders in the Aegean region are scarce. In this study, we focused on the phylogeography of the endemic ctenizid trap-door spider Cyrtocarenum Ausserer, 1871. The genus includes two morphologically described species: C. grajum (C.L. Koch, 1836) and C. cunicularium (Olivier, 1811). We sampled 60 specimens from the distributions of both species and analyzed four mitochondrial and two nuclear markers. Cyrtocarenum served as an example to demonstrate the importance of natural history traits in the inference of phylogeographic scenarios. The mtDNA substitution rates inferred for the genus are profoundly higher compared to araneomorph spiders and other arthropods, which seems tightly associated with their biology. We evaluate published mtDNA substitution rates followed in the literature for mygalomorph spiders and discuss potential pitfalls. Following gene tree (maximum likelihood, Bayesian inference) and species tree approaches ((*)BEAST), we reconstructed a time-calibrated phylogeny of the genus. These results, combined with a biogeographical ancestral-area analysis, helped build a biogeographic scenario that describes how the major palaeogeographic and palaeoclimatic events of the Aegean may have affected the distribution of Cyrtocarenum lineages. The diversification of the genus seems to have begun in the Middle Miocene in the present west Aegean area, while major phylogenetic events occurred at the Miocene-Pliocene boundary for C. cunicularium, probably related to the Messinian Salinity Crisis. Our results also demonstrate the clear molecular distinction of the two morphologically described species, but possible cryptic lineages may exist within C. cunicularium.},
}

Animals
Bayes Theorem
Cell Nucleus/genetics
Climate
DNA, Mitochondrial/*genetics
Greece
Mitochondria/genetics
*Mutation Rate
*Phylogeny
Phylogeography
Spiders/*genetics
Turkey

@article {pmid26887409,
year = {2016},
author = {Strassert, JF and Tikhonenkov, DV and Pombert, JF and Kolisko, M and Tai, V and Mylnikov, AP and Keeling, PJ},
title = {Moramonas marocensis gen. nov., sp. nov.: a jakobid flagellate isolated from desert soil with a bacteria-like, but bloated mitochondrial genome.},
journal = {Open biology},
volume = {6},
number = {2},
pages = {150239},
pmid = {26887409},
issn = {2046-2441},
mesh = {Base Sequence ; DNA, Ribosomal/genetics ; *Desert Climate ; Eukaryota/*classification/*genetics/isolation & purification/ultrastructure ; Flagella/ultrastructure ; Gene Order ; *Genome, Mitochondrial ; Nucleotide Motifs ; Phylogeny ; *Soil Microbiology ; },
abstract = {A new jakobid genus has been isolated from Moroccan desert soil. The cyst-forming protist Moramonas marocensis gen. nov., sp. nov. has two anteriorly inserted flagella of which one points to the posterior cell pole accompanying the ventral feeding groove and is equipped with a dorsal vane-a feature typical for the Jakobida. It further shows a flagellar root system consisting of singlet microtubular root, left root (R1), right root (R2) and typical fibres associated with R1 and R2. The affiliation of M. marocensis to the Jakobida was confirmed by molecular phylogenetic analyses of the SSU rRNA gene, five nuclear genes and 66 mitochondrial protein-coding genes. The mitochondrial genome has the high number of genes typical for jakobids, and bacterial features, such as the four-subunit RNA polymerase and Shine-Dalgarno sequences upstream of the coding regions of several genes. The M. marocensis mitochondrial genome encodes a similar number of genes as other jakobids, but is unique in its very large genome size (greater than 264 kbp), which is three to four times higher than that of any other jakobid species investigated yet. This increase seems to be due to a massive expansion in non-coding DNA, creating a bloated genome like those of plant mitochondria.},
}

Base Sequence
DNA, Ribosomal/genetics
*Desert Climate
Eukaryota/*classification/*genetics/isolation & purification/ultrastructure
Flagella/ultrastructure
Gene Order
*Genome, Mitochondrial
Nucleotide Motifs
Phylogeny
*Soil Microbiology

@article {pmid26914395,
year = {2016},
author = {Kosuda, S and Sasakawa, K and Ikeda, H},
title = {Directional mitochondrial introgression and character displacement due to reproductive interference in two closely related Pterostichus ground beetle species.},
journal = {Journal of evolutionary biology},
volume = {29},
number = {6},
pages = {1121-1130},
doi = {10.1111/jeb.12852},
pmid = {26914395},
issn = {1420-9101},
mesh = {Animals ; *Coleoptera ; Female ; Hybridization, Genetic ; Male ; Mitochondria ; *Phylogeny ; *Reproduction ; Sympatry ; },
abstract = {Reproductive interference due to interspecific hybridization can lead to character displacement among related species with overlapping ranges. However, no studies have examined which reproductive traits are most important in reducing reproductive interference. We conducted molecular analyses of two nuclear genes (28S and Wingless) and a mitochondrial gene (COI) from two closely related ground beetle species, Pterostichus thunbergi and Pterostichus habui (Coleoptera: Carabidae), with overlapping distributions. In addition, we examined four reproductive traits (body size, organ morphologies of intromittent and non-intromittent male genital organs, and female reproductive period) in sympatric and allopatric habitats. We compared male genital morphology using geometric morphometric analysis. The species determined by morphology were classified into separate groups based on the phylogenetic tree constructed by the nuclear gene (Wingless). However, according to the mitochondrial genes examined, P. thunbergi was not monophyletic, whereas at the sympatric sites, these species formed a monophyletic clade. This incongruence suggests that interspecific hybridization and subsequent mitochondrial introgression from P. habui to P. thunbergi have occurred. Concerning genital morphology, both of the intromittent and nonintromittent organs of P. thunbergi differed more from P. habui at the sympatric sites than between allopatric sites, suggesting reproductive character displacement. Pterostichus thunbergi, which likely arrived in P. habui habitat in small numbers, would have experienced stronger selection pressures than P. habui.},
}

Animals
*Coleoptera
Female
Hybridization, Genetic
Male
Mitochondria
*Phylogeny
*Reproduction
Sympatry